Literature DB >> 16704793

Pneumonia and new methicillin-resistant Staphylococcus aureus clone.

Fabien Garnier1, Anne Tristan, Bruno François, Jerome Etienne, Manuella Delage-Corre, Christian Martin, Nadia Liassine, Wim Wannet, François Denis, Marie-Cécile Ploy.   

Abstract

Necrotizing pneumonia caused by Staphylococcus aureus strains carrying the Panton-Valentin leukocidin gene is a newly described disease entity. We report a new fatal case of necrotizing pneumonia. An S. aureus strain with an agr1 allele and of a new sequence type 377 was recovered, representing a new, emerging, community-acquired methicillin-resistant clone.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16704793      PMCID: PMC3291452          DOI: 10.3201/eid1203.051040

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Necrotizing pneumonia associated with Panton-Valentine leukocidin (PVL) is a recent described clinical entity. It mainly occurs in children and young adults (median age 15 years), is fatal in 75% of cases, and is associated with a median survival time of 4 days (). Necrotizing pneumonia is often preceded by a viral-like illness with signs of rhinopharyngitis. Viruses such as the influenza A virus have been isolated concomitantly with the PVL-positive S. aureus (). Clinically, necrotizing pneumonia is mainly characterized by a rapidly extensive pneumonia often associated with pleural effusion and progressing towards the acute respiratory distress syndrome. Major associated signs include hemoptysis and leukopenia (<2 × 109/L) (). The severity of necrotizing pneumonia could be due to the products of the PVL genes, which are present in all S. aureus strains associated with this disease. The precise pathophysiology of the disease is unknown, but PVL causes tissue necrosis and leukocyte destruction. This toxin has been linked to primary skin and soft-tissue infections such as furuncles and abscesses (). Necrotizing pneumonia is mainly associated with PVL-positive methicillin-susceptible Staphylococcus aureus strains. Only 1 of the 16 cases reported by Gillet et al. () and 6 of the 40 cases of necrotizing pneumonia reported in the literature were associated with methicillin-resistant strains (MRSA). These PVL-positive MRSA correspond to clones that have emerged worldwide and cause community-acquired (CA) infections in patients with no risk factors. These CA-MRSA clones have a continent-specific distribution or worldwide distribution described by Vandenesch et al. (). CA-MRSA clones that have spread worldwide share SCCmec type IV, the smallest cassette containing the mecA gene coding for methicillin resistance. The major European clone has a sequence type (ST) 80, as determined by multilocus sequence typing, and an agr (for accessory gene regulator) allele of type 3. agr is a global regulator controlling the expression of virulence factors in S. aureus, and has 4 alleles (). PVL-positive CA-MRSA isolated in Australia have an agr type 3 allele and are of ST30 or ST93. The PVL-positive CA-MRSA isolated in the United States are ST1 and agr allele type 3, but some are ST8 or ST59 and agr allele type 1 (). Here we report a fatal case of necrotizing pneumonia involving a 59-year-old woman infected by a new clone of PVL-positive CA-MRSA.

Case Report

A 59-year-old woman with an unremarkable medical history was admitted to Limoges University Hospital (France) in December 2003 for acute respiratory failure. She had a 3-day history of flulike syndrome with fever, chills, cough, and myalgia and had been prescribed nonsteroidal antiinflammatory therapy. On admission, she had dyspnea, nonproductive cough, and rales in both lungs. Her arterial pressure was 60/30 mm Hg. Skin rash and diarrhea were absent. A chest radiograph showed diffuse alveolar infiltration of both lungs, without pleural effusion. Laboratory studies showed leukopenia (leukocytes = 1.66 × 109/L), mild thrombocytopenia (115,000 platelets/mm3), hypoxemia (PaO2/FiO2 = 61), and lactic acidosis (pH = 7.29, lactates = 4.45 mmol/L). Empirical antibacterial chemotherapy combining ceftriaxone, ciprofloxacin, and gentamicin was started on admission, and mechanical ventilation was immediately necessary. Repeated tracheal aspiration was highly productive and showed hemoptysis and sustained intraalveolar plasma leakage. Despite fluid resuscitation, continuous catecholamines perfusion, dortrecogin alfa (activated) administration (Xigris, Eli Lilly and Company, Indianapolis, IN, USA), and aggressive care, her hemodynamic status deteriorated rapidly, leading to multiple organ failure and death <24 hours after admission. Necropsy showed hemorrhagic foci in both lungs. Histopathologic studies showed total destruction of the respiratory epithelium covering the bronchi and bronchioli, together with abundant gram-positive cocci, absence of viable polymorphonuclear cells, and extensive necrosis of the alveolar septa. These lesions were characteristics of necrotizing pneumonia. S. aureus was isolated 3 times, by culture of blood (LIM-48), lung necropsy tissue (LIM-49), and tracheal aspirate (LIM-50). The 3 isolates had the same antimicrobial drug resistance profile (resistant to oxacillin, kanamycin, tobramycin, and gentamicin) and the same pattern by pulsed-field gel electrophoresis after DNA digestion by SmaI (data not shown). Influenza A virus was detected by polymerase chain reaction and immunofluorescence on the tracheal aspirate, but culture on cell lines was negative. The influenza A virus has been shown to be capable of destroying the respiratory epithelium from the trachea to the bronchioli (), allowing the PVL-positive CA-MRSA to adhere to the basement membrane (). PVL may diffuse locally, attracting polymorphonuclear leukocytes by its chemotactic activity and lysing them by its leukotoxicity. Because the clinical manifestations corresponded to those of necrotizing pneumonia, isolate LIM-49 was referred (lung necropsy culture) to the French National Centre for Staphylococci. The isolate was screened for staphylococcal toxin genes, agr alleles, and the mecA gene as described elsewhere (Table) (,,). The strain had an agr type 1 allele and the lukS-PV/lukF-PV genes encoding PVL (Figure), but harbored no toxin genes (sea through see, tsst, eta, and etb genes encoding staphylococcal enterotoxins A though E, toxic shock syndrome toxin, and exfoliative toxins A and B, respectively). The mecA gene was detected, together with SCCmec type V as described by Ito et al. (). The spa type was 355 and the sequence type was ST377 (Figure). The single nucleotide difference between ST152 and ST377, which is not distinguished by using the usual primers determined by Enright et al. (), was established as ST377 by using in-house primers (forward 5´-ggA CgA Agg TCA TgA TgT ATT TTT-3´ (nt 327–350), reverse 5´-CTT CTA CgC gCT CTC TTT TTA Ag-3´ (nt 564–586), according to the GenBank ID11211186 of the gmk gene) to amplify appropriate fragment. To our knowledge, this is the first description of such a necrotizing pneumonia–associated CA-MRSA clone. Three other ST377 strains were referred to the National Reference Centre for staphylococci in 2003. Two were isolated from patients in Europe (Netherlands and Switzerland), and 1 from an Australia patient (strain provided by G. Nimmo). The patient from the Netherlands had been treated for an abscess from which PVL-MRSA was cultured, and the Swiss patient had furunculosis. The 3 isolates harbored the SCCmec type V cassette, an agr1 allele, the same toxin gene profile, and macrorestriction pattern, spa type, as our isolate (Figure).
Table

Primers used to screen for staphylococcal toxin genes, agr alleles, and mecA gene

GenePrimerOligonucleotide sequence (5´–3´)Reference
mecA mecA-1AAAATCGATGGTAAAGGTTGGC (6)
mecA-2AGTTCTGCAGTACCGGATTTGC
agr1 agr1-1ATGCACATGGTGCACATGC (5)
agr1-2GTCACAAGTACTATAAGCTGCGAT
agr2 agr2-1ATGCACATGGTGCACATGC (5)
agr2-2TATTACTAATTGAAAAGTGCCATAGC
agr3 agr3-1ATGCACATGGTGCACATGC (5)
agr3-2GTAATGTAATAGCTTGTATAATAATACCCAG
agr4 agr4-1ATGCACATGGTGCACATGC (5)
agr4-2CGATAATGCCGTAATACCCG
sea sea-1GAAAAAAGTCTGAATTGCAGGGAACA (3)
sea-2CAAATAAATCGTAATTAACCGAAGGTTC
seb seb-1ATTCTAATTAAGGACACTAAGTTAGGGA (3)
seb-2ATCCCGTTTCATAAGGCGAGT
sec sec-1GTAAAGTTACAGGTGGCAAAACTTG (3)
sec-2CATATCATACCAAAAAGTATTGCCGT
sed sed-1GAATTAAGTAGTACCGCGCTAAATAATATG (3)
sed-2GCTGTATTTTTCCTCCGAGAGT
see see-1CAAAGAAATGCTTTAAGCAATCTTAGGC (3)
see-2CACCTTACCGCCAAAGCTG
tsst tsst-1TTCACTATTTGTAAAAGTGTCAGACCCACT (3)
tsst-2TACTAATGAATTTTTTTATCGTAAGCCCTT
eta eta-1ACTGTAGGAGCTAGTGCATTTGT (3)
eta-2TGGATACTTTTGTCTATCTTTTTCATCAAC
etb etb-1CAGATAAAGAGCTTTATACACACATTAC (3)
etb-2AGTGAACTTATCTTTCTATTGAAAAACACTC
LukS-PV/lukF-PVpvl-1ATCATTAGGTAAAATGTCTGGACATGATCCA (3)
Npvl-2GCATCAASTGTATTGGATAGCAAAAGC
Figure

Pulsed-field gel electrophoresis (PFGE) pattern and phylogenetic tree of 4 strains ST377. SmaI macrorestriction patterns were digitized and analyzed by using GelCompar II (Applied Maths, Kortrijk, Belgium) to calculate Dice coefficients of correlation and to generate a dendrogram by the unweighted pair group method using arithmetic averages clustering. The scale indicates the level of pattern similarity. PVL, Panton-Valentine leukocidin; ST, sequence type.

Pulsed-field gel electrophoresis (PFGE) pattern and phylogenetic tree of 4 strains ST377. SmaI macrorestriction patterns were digitized and analyzed by using GelCompar II (Applied Maths, Kortrijk, Belgium) to calculate Dice coefficients of correlation and to generate a dendrogram by the unweighted pair group method using arithmetic averages clustering. The scale indicates the level of pattern similarity. PVL, Panton-Valentine leukocidin; ST, sequence type.

Conclusions

We report the identification of a new, emerging, highly virulent PVL-positive CA-MRSA clone that harbors the SCCmec type V cassette. This tends to confirm the continuing emergence of new CA-MRSA clones. The new clone seems to have spread rapidly in Europe, because it has been detected in patients in the Netherlands, Switzerland, and now in France. Since necrotizing pneumonia is rapidly fatal, as in the patient described here, cases of PVL-positive CA-MRSA infection must be recognized rapidly, especially in case of methicillin resistance. The therapeutic value of intravenous immunoglobulin containing anti-PVL antibodies has been reported by Gauduchon et al. () but must be confirmed.
  9 in total

1.  Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrC.

Authors:  Teruyo Ito; Xiao Xue Ma; Fumihiko Takeuchi; Keiko Okuma; Harumi Yuzawa; Keiichi Hiramatsu
Journal:  Antimicrob Agents Chemother       Date:  2004-07       Impact factor: 5.191

2.  Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients.

Authors:  Yves Gillet; Bertrand Issartel; Philippe Vanhems; Jean-Christophe Fournet; Gerard Lina; Michèle Bes; François Vandenesch; Yves Piémont; Nicole Brousse; Daniel Floret; Jerome Etienne
Journal:  Lancet       Date:  2002-03-02       Impact factor: 79.321

3.  Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease.

Authors:  Sophie Jarraud; Christophe Mougel; Jean Thioulouse; Gerard Lina; Hélène Meugnier; Françoise Forey; Xavier Nesme; Jerome Etienne; François Vandenesch
Journal:  Infect Immun       Date:  2002-02       Impact factor: 3.441

4.  Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction.

Authors:  K Murakami; W Minamide; K Wada; E Nakamura; H Teraoka; S Watanabe
Journal:  J Clin Microbiol       Date:  1991-10       Impact factor: 5.948

5.  Neutralization of Staphylococcus aureus Panton Valentine leukocidin by intravenous immunoglobulin in vitro.

Authors:  Valérie Gauduchon; Gregoire Cozon; François Vandenesch; Anne-Laure Genestier; Nathalie Eyssade; Simone Peyrol; Jerome Etienne; Gerard Lina
Journal:  J Infect Dis       Date:  2004-01-09       Impact factor: 5.226

6.  Staphylococcus aureus isolates associated with necrotizing pneumonia bind to basement membrane type I and IV collagens and laminin.

Authors:  Sophie de Bentzmann; Anne Tristan; Jerome Etienne; Nicole Brousse; Francois Vandenesch; Gerard Lina
Journal:  J Infect Dis       Date:  2004-09-15       Impact factor: 5.226

7.  Bacterial competition for human nasal cavity colonization: role of Staphylococcal agr alleles.

Authors:  Gerard Lina; Florent Boutite; Anne Tristan; Michèle Bes; Jerome Etienne; Francois Vandenesch
Journal:  Appl Environ Microbiol       Date:  2003-01       Impact factor: 4.792

8.  Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus.

Authors:  M C Enright; N P Day; C E Davies; S J Peacock; B G Spratt
Journal:  J Clin Microbiol       Date:  2000-03       Impact factor: 5.948

9.  Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence.

Authors:  Francois Vandenesch; Timothy Naimi; Mark C Enright; Gerard Lina; Graeme R Nimmo; Helen Heffernan; Nadia Liassine; Michèle Bes; Timothy Greenland; Marie-Elisabeth Reverdy; Jerome Etienne
Journal:  Emerg Infect Dis       Date:  2003-08       Impact factor: 6.883

  9 in total
  22 in total

1.  Human CD45 is an F-component-specific receptor for the staphylococcal toxin Panton-Valentine leukocidin.

Authors:  Angelino T Tromp; Michiel Van Gent; Pauline Abrial; Amandine Martin; Joris P Jansen; Carla J C De Haas; Kok P M Van Kessel; Bart W Bardoel; Elisabeth Kruse; Emilie Bourdonnay; Michael Boettcher; Michael T McManus; Christopher J Day; Michael P Jennings; Gérard Lina; François Vandenesch; Jos A G Van Strijp; Robert Jan Lebbink; Pieter-Jan A Haas; Thomas Henry; András N Spaan
Journal:  Nat Microbiol       Date:  2018-05-07       Impact factor: 17.745

2.  Identification of the capsular polysaccharides in Staphylococcus aureus clinical isolates by PCR and agglutination tests.

Authors:  Isabelle Verdier; Geraldine Durand; Michele Bes; Kimberly L Taylor; Gerard Lina; François Vandenesch; Ali I Fattom; Jerome Etienne
Journal:  J Clin Microbiol       Date:  2007-01-03       Impact factor: 5.948

3.  CD80/CD86 signaling contributes to the proinflammatory response of Staphylococcus aureus in the airway.

Authors:  Dane Parker
Journal:  Cytokine       Date:  2018-07       Impact factor: 3.861

4.  Genetic characterization of Panton-Valentine leukocidin-producing methicillin-resistant Staphylococcus aureus in Western Austria.

Authors:  Michael Berktold; Katharina Grif; Martin Mäser; Wolfgang Witte; Reinhard Würzner; Dorothea Orth-Höller
Journal:  Wien Klin Wochenschr       Date:  2012-09-28       Impact factor: 1.704

Review 5.  Immunopathogenesis of Staphylococcus aureus pulmonary infection.

Authors:  Dane Parker; Alice Prince
Journal:  Semin Immunopathol       Date:  2011-10-31       Impact factor: 9.623

Review 6.  Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic.

Authors:  Michael Z David; Robert S Daum
Journal:  Clin Microbiol Rev       Date:  2010-07       Impact factor: 26.132

7.  Familial furunculosis associated with community-acquired leukocidin-positive methicillin-susceptible Staphylococcus aureus ST152.

Authors:  E Pérez-Roth; J Alcoba-Flórez; C López-Aguilar; I Gutiérrez-González; B Rivero-Pérez; S Méndez-Alvarez
Journal:  J Clin Microbiol       Date:  2009-11-11       Impact factor: 5.948

8.  Molecular and epidemiological evidence for spread of multiresistant methicillin-susceptible Staphylococcus aureus strains in hospitals.

Authors:  Pierre-Yves Donnio; Frédéric Février; Pablo Bifani; Marie Dehem; Christèle Kervégant; Nathalie Wilhelm; Anne-Lise Gautier-Lerestif; Nathalie Lafforgue; Michel Cormier; Alain Le Coustumier
Journal:  Antimicrob Agents Chemother       Date:  2007-08-20       Impact factor: 5.191

9.  CD4+ T cells promote the pathogenesis of Staphylococcus aureus pneumonia.

Authors:  Dane Parker; Chanelle L Ryan; Francis Alonzo; Victor J Torres; Paul J Planet; Alice S Prince
Journal:  J Infect Dis       Date:  2014-09-19       Impact factor: 5.226

10.  Global distribution of Panton-Valentine leukocidin--positive methicillin-resistant Staphylococcus aureus, 2006.

Authors:  Anne Tristan; Michele Bes; Helene Meugnier; Gerard Lina; Bülent Bozdogan; Patrice Courvalin; Marie-Elisabeth Reverdy; Mark C Enright; François Vandenesch; Jerome Etienne
Journal:  Emerg Infect Dis       Date:  2007-04       Impact factor: 6.883

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.