Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana.

Literature DB >> 16667505

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana.

Abstract

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.

Entities: Gene Species

Year: 1990 PMID： 16667505 PMCID： PMC1062552 DOI： 10.1104/pp.93.2.572

Source DB: PubMed Journal: Plant Physiol ISSN： 0032-0889 Impact factor: 8.340

24 in total

1. cis-Acting Elements for Light Regulation of Pea Ferredoxin I Gene Expression Are Located within Transcribed Sequences.

Authors: R. C. Elliott; L. F. Dickey; M. J. White; W. F. Thompson
Journal: Plant Cell Date: 1989-07 Impact factor: 11.277

2. Organ-specific and light-induced expression of plant genes.

Authors: R Fluhr; C Kuhlemeier; F Nagy; N H Chua
Journal: Science Date: 1986-05-30 Impact factor: 47.728

3. An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene.

Authors: G Giuliano; E Pichersky; V S Malik; M P Timko; P A Scolnik; A R Cashmore
Journal: Proc Natl Acad Sci U S A Date: 1988-10 Impact factor: 11.205

4. A CACGTG motif of the Antirrhinum majus chalcone synthase promoter is recognized by an evolutionarily conserved nuclear protein.

Authors: D Staiger; H Kaulen; J Schell
Journal: Proc Natl Acad Sci U S A Date: 1989-09 Impact factor: 11.205

5. Isolation and expression of an anther-specific gene from tomato.

Authors: D Twell; R Wing; J Yamaguchi; S McCormick
Journal: Mol Gen Genet Date: 1989-06

6. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.

Authors: A P Feinberg; B Vogelstein
Journal: Anal Biochem Date: 1983-07-01 Impact factor: 3.365

7. Novel phytochrome sequences in Arabidopsis thaliana: structure, evolution, and differential expression of a plant regulatory photoreceptor family.

Authors: R A Sharrock; P H Quail
Journal: Genes Dev Date: 1989-11 Impact factor: 11.361

8. Amino acid sequences of ferredoxin isoproteins from radish roots.

Authors: K Wada; M Onda; H Matsubara
Journal: J Biochem Date: 1989-04 Impact factor: 3.387

9. Sequences in the pea rbcS-3A gene have homology to constitutive mammalian enhancers but function as negative regulatory elements.

Authors: C Kuhlemeier; R Fluhr; P J Green; N H Chua
Journal: Genes Dev Date: 1987-05 Impact factor: 11.361

10. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

Authors: C Castresana; I Garcia-Luque; E Alonso; V S Malik; A R Cashmore
Journal: EMBO J Date: 1988-07 Impact factor: 11.598

19 in total

1. Stearoyl-acyl carrier protein and unusual acyl-acyl carrier protein desaturase activities are differentially influenced by ferredoxin.

Authors: D J Schultz; M C Suh; J B Ohlrogge
Journal: Plant Physiol Date: 2000-10 Impact factor: 8.340

10. The 5' end of the pea ferredoxin-1 mRNA mediates rapid and reversible light-directed changes in translation in tobacco.

Authors: E R Hansen; M E Petracek; L F Dickey; W F Thompson
Journal: Plant Physiol Date: 2001-02 Impact factor: 8.340

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana.

1. cis-Acting Elements for Light Regulation of Pea Ferredoxin I Gene Expression Are Located within Transcribed Sequences.

2. Organ-specific and light-induced expression of plant genes.

3. An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene.

4. A CACGTG motif of the Antirrhinum majus chalcone synthase promoter is recognized by an evolutionarily conserved nuclear protein.

5. Isolation and expression of an anther-specific gene from tomato.

6. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.

7. Novel phytochrome sequences in Arabidopsis thaliana: structure, evolution, and differential expression of a plant regulatory photoreceptor family.

8. Amino acid sequences of ferredoxin isoproteins from radish roots.

9. Sequences in the pea rbcS-3A gene have homology to constitutive mammalian enhancers but function as negative regulatory elements.

10. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

1. Stearoyl-acyl carrier protein and unusual acyl-acyl carrier protein desaturase activities are differentially influenced by ferredoxin.

2. New nucleotide sequence data on the EMBL file server.

3. Chromosomal location of the genes for ferredoxin in wheat, barley and rye.

4. Cloning and characterization of tomato leaf senescence-related cDNAs.

5. Temporal and spatial distribution of ferredoxin isoproteins in tomato fruit.

6. Interactions between Light and the Circadian Clock in the Regulation of CAT2 Expression in Arabidopsis.

7. A post genomic characterization of Arabidopsis ferredoxins.

8. Arabidopsis COP8, COP10, and COP11 genes are involved in repression of photomorphogenic development in darkness.

9. A novel iron-regulated metal transporter from plants identified by functional expression in yeast.

10. The 5' end of the pea ferredoxin-1 mRNA mediates rapid and reversible light-directed changes in translation in tobacco.