| Literature DB >> 16556301 |
Agnès Burel1, Thomas Mouchel, Sylvie Odent, Filiz Tiker, Bertrand Knebelmann, Isabelle Pellerin, Daniel Guerrier.
Abstract
The Mayer-Rokitansky-Küster-Hauser (MRKH) syndrome refers to the congenital absence or severe hypoplasia of the female genital tract, often described as uterovaginal aplasia which is the prime feature of the syndrome. It is the second cause of primary amenorrhea after gonadal dysgenesis and occurs in approximately 1 in 4500 women. Aetiology of this syndrome remains poorly understood. Frequent association of other malformations with the MRKH syndrome, involving kidneys, skeleton and ears, suggests the involvement of major developmental genes such as those of the HOX family. Indeed mammalian HOX genes are well known for their crucial role during embryogenesis, particularly in axial skeleton, hindbrain and limb development. More recently, their involvement in organogenesis has been demonstrated notably during urogenital differentiation. Although null mutations of HOX genes in animal models do not lead to MRKH-like phenotypes, dominant mutations in their coding sequences or aberrant expression due to mutated regulatory regions could well account for it. Sequence analysis of coding regions of HOX candidate genes and of PBX1, a likely HOX cofactor during Müllerian duct differentiation and kidney morphogenesis, did not reveal any mutation in patients showing various forms of MRKH syndrome. This tends to show that HOX genes are not involved in MRKH syndrome. However it does not exclude that other mechanisms leading to HOX dysfunction may account for the syndrome.Entities:
Mesh:
Substances:
Year: 2006 PMID: 16556301 PMCID: PMC1444933 DOI: 10.1186/1477-5751-5-4
Source DB: PubMed Journal: J Negat Results Biomed ISSN: 1477-5751
Forward (F) and reverse (R) primers used for PCR-mediated amplification of genomic DNA of HOXA7 to HOXA13 genes exons.
| HOXA 7-1-F | HOXA-7 exon 1 | TTGGTGTAAATCTGGGGGTG | 637 |
| HOXA 7-2-F | HOXA-7 exon 2 | GACTAGGCCAGGAGGAAGGT | 697 |
| HOXA 9-1a-F | HOXA-9 exon 1 (first half) | TGCCACCAAGTTGTTACATGA | 492 |
| HOXA 9-1b-F | HOXA-9 exon 1 (second half) | GCAGGTACATGCGCTCCT | 356 |
| HOXA 9-2-F | HOXA-9 exon 2 | TGTGCGTCTTCTGCTCCTAA | 343 |
| HOXA 10-1a-F | HOXA-10 exon 1 (first half) | CTCCTGGCCCATCAATACAG | 728 |
| HOXA 10-1b-F | HOXA-10 exon 1 (second half) | GCGCAGAACATCAAAGAAGA | 535 |
| HOXA 10-2-F | HOXA-10 exon 2 | TGGCCTCGACTTAATCATCC | 378 |
| HOXA 11-1a-F | HOXA-11 exon 1 (first half) | CAGCTGCAGTGGAGAATCAT | 562 |
| HOXA 11-1b-F | HOXA-11 exon 1 (second half) | TTTTTCGAGACAGCCTACGG | 340 |
| HOXA 11-2-F | HOXA-11 exon 2 | CTCACCCCATGCCTTTTCT | 331 |
| HOXA 13-1a-F | HOXA-13 exon 1 (first half) | ACTGGGGTCTTCTCCATGC | 727 |
| HOXA 13-1b-F | HOXA-13 exon 1 (second half) | CAACGCCATCAAGTCGTG | 389 |
| HOXA 13-2-F | HOXA-13 exon 2 | CCGATCCCTGTGTAACTTGC | 331 |
Forward (F) and reverse (R) primers used for PCR-mediated amplification of genomic DNA of PBX1 gene exons.
| PBX1-1-F | PBX1 exon 1 | TTTCCCCCTTCCCTGTTTAT | 334 |
| PBX1-2-F | PBX1 exon 2 | CAAATGTTTTCACCCTGTGC | 223 |
| PBX1-3-F | PBX1 exon 3 | TGGCAGCTTATGTAGCCAAA | 404 |
| PBX1-4-F | PBX1 exon 4 | GCCCACGTGGCCTAATGTCATA | 372 |
| PBX1-5-F | PBX1 exon 5 | TGCTCCAAATTCACCTTTTG | 331 |
| PBX1-6-F | PBX1 exon 6 | TTCACCTCTCCCATAAAGCC | 324 |
| PBX1-7-F | PBX1 exon 7 | GGTTGCTTTGCATGTCATTC | 354 |
| PBX1-8-F | PBX1 exon 8 | TCTGCCTCCCTTTTCCTACA | 304 |
| PBX1-9-F | PBX1 exon 9 | AAACAGCCACCCAATCTCAG | 261 |