Literature DB >> 16519809

Search for genetic variants in the p66Shc longevity gene by PCR-single strand conformational polymorphism in patients with early-onset cardiovascular disease.

Federica Sentinelli1, Stefano Romeo, Fabrizio Barbetti, Andrea Berni, Emanuela Filippi, Marzia Fanelli, Mara Fallarino, Marco G Baroni.   

Abstract

BACKGROUND: Among the possible candidate genes for atherosclerosis experimental data point towards the longevity gene p66Shc. The p66Shc gene determines an increase of intracellular reactive oxygen species (ROS), affecting the rate of oxidative damage to nucleic acids. Knock-out p66Shc-/- mice show reduction of systemic oxidative stress, as well as of plasma LDL oxidation, and reduced atherogenic lesions. Thus, p66Shc may play a pivotal role in controlling oxidative stress and vascular dysfunction in vivo.
METHODS: We searched for sequence variations in the p66Shc specific region of the Shc gene and its upstream promoter by PCR-SSCP in a selected group of early onset coronary artery disease (CAD) subjects (n. 78, mean age 48.5 +/- 6 years) and in 93 long-living control subjects (mean age 89 +/- 6 years).
RESULTS: The analysis revealed two variant bands. Sequencing of these variants showed two SNPs: -354T>C in the regulatory region of p66Shc locus and 92C>T in the p66 specific region (CH2). Both these variants have never been described before. The first substitution partially modifies the binding consensus sequence of the Sp1 transcription factor, and was detected only in two heterozygous carriers (1 CAD subjects and 1 control subject). The 92C>T substitution in the CH2 region consists in an amino acid substitution at codon 31 (proline to leucine, P31L), and was detected in heterozygous status only in one CAD subject. No subjects homozygous for the two newly described SNPs were found.
CONCLUSION: Only two sequence variations in the p66Shc gene were observed in a total of 171 subjects, and only in heterozygotes. Our observations, in accordance to other studies, suggest that important variations in the p66Shc gene may be extremely rare and probably this gene is not involved in the genetic susceptibility to CAD.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16519809      PMCID: PMC1420326          DOI: 10.1186/1471-2156-7-14

Source DB:  PubMed          Journal:  BMC Genet        ISSN: 1471-2156            Impact factor:   2.797


Background

Increasing evidence indicates that reactive oxygen species (ROS) may participate in the pathogenesis of various diseases, including cardiovascular disorders. Support to this comes from the experimental demonstration that vessel walls of patients with atherosclerotic risk factors are characterized by a significant increase in vascular ROS production [1]. It has been reported that the p66Shc longevity gene increases intracellular reactive oxygen species (ROS), thereby affecting the rate of oxidative damage to nucleic acids [2]. The human Shc locus (Src homologous and collagen) encodes three proteins with relative molecular masses of 46K (p46Shc), 52K (p52Shc) and 66K (p66Shc). All three proteins share a Src-homology2 (SH2) domain, a collagen-homology (CH1) region and a phosphotyrosine-binding (PTB) domain. The p66Shc protein contains a unique amino terminal region (CH2) [3]. p46Shc, p52Shc and p66Shc are adaptor proteins in the insulin-signalling pathway, but their downstream effects differ: p46Shc and p52Shc are tyrosine-phosphorylated by a variety of growth factors, and are associated with MAPK signalling; p66Shc also undergoes tyrosine phosphorylation in response to extracellular signals but is involved in signal transduction pathways that inhibits the activation of c-fos promoter [4]. C-fos is transcriptionally activated in response to environmental stresses such as ultraviolet light (UV) or H2O2. Thus, there is in vitro evidence that p66Shc is part of a complex transduction pathway that controls oxidative stress [4]. Knock out mice for the p66Shc gene locus show a higher resistance to oxidative stress and extended life span (up to 30%) [3]. Moreover, p66Shc-/- cells show a reduced oxidative stress-induced apoptosis, which is restored by p66Shc over expression [3]. Also, the role of p66Shc in muscle damage that follows acute hindlimb ischemia has been investigated. Results showed that p66Shc-/- mice were resistant to tissue damage induced by ischemia and ischemia/reperfusion secondary to ROS generation, demonstrating that p66Shc plays a crucial role in the cell death pathways activated by acute ischemia [5]. Further studies using p66Shc-/- mice showed a significant reduction of systemic oxidative stress, plasma LDL oxidation and early atherosclerotic lesions when mice were fed a high-fat diet [6]. p66Shc expression is tissue specific [7] and it is regulated by epigenetic modifications, namely histone deacetylation and cytosine methylation. In this regard, it has been reported that histone deacetylase inhibitors and demethylating agents restore p66Shc expression in human peripheral blood lymphocytes (PBL) that normally do not express this isoform [8]. More recent studies have observed that absence of p66Shc expression might contribute to the protection of the heart from the deleterious effects of elevated Angiotensis II levels [9]. Furthermore, it was reported that inactivation of the p66Shc gene protects against age-dependent ROS-mediated endothelial dysfunction [10] in p66Shc KO mice. It appears therefore that p66Shc may play a pivotal role in controlling oxidative stress and vascular dysfunction in vivo, possibly regulating the evolution of the atherosclerotic process. Based on this background, we investigated the p66Shc specific region of the Shc gene and its upstream promoter for variations in a selected group of subjects with early-onset coronary artery disease (CAD).

Results

The possible effect of p66Shc longevity gene mutations on CAD would probably determine an early onset of the disease, and assuming that a genetic effect might be more evident in younger patients, we choose to select subjects with age of diagnosis of CAD <55 years. This age limit was based on the incidence curves of CAD and the estimates of genetic effect at various ages [11,12]. As controls we studied 93 unrelated long-living subjects (mean age 89 ± 6 years) randomly selected from a population of individuals screened for CAD risk factors. The human Shc locus encodes three proteins (p46, p52 and p66) by using two alternative promoters that synthesize two mRNAs coding for p46/p52 and for p66 [8]. The p66Shc promoter, positioned in the first intron of the Shc locus, contains a relative high frequency of CpG dinucleotides whose methylation regulates the transcriptional activity of p66Shc promoter [8]. Considering the recent observations that alterations in expression of p66Shc gene might be one possible cause in determining life span and in controlling oxidative stress, we hypothesised that sequence variations in p66Shc promoter may contribute to both aging and early atherogenesis. PCR-SSCP analysis of the p66 specific region of the Shc locus and the p66Shc promoter (from nucleotide -637) revealed two variant bands (Figure 1). Sequencing of these variants showed two SNPs: -354T>C in the regulatory region of p66Shc locus and 92C>T in the p66 specific region (CH2). The first substitution partially modifies the binding consensus sequence of the Sp1 transcription factor, and was detected only in two heterozygous carriers (1 CAD subject and 1 control subject). The 92C>T substitution in the CH2 region consists in an amino acid substitution at codon 31 in which proline is substituted with leucine (P31L), and was detected in heterozygous status only in one CAD subject. No subjects homozygous for the two newly described SNPs were found. One family member of the subject carrying the P31L mutation, also affected by early-onset CAD (the brother, age 37 years), was screened for these new polymorphisms, but no SNPs were detected.
Figure 1

Mutation detection with SSCP and sequence electropherograms of p66. PCR-SSCP and sequence analysis of the regulatory region of p66Shc locus (A) and of the p66Shc specific region CH2 (B). In the sequence electropherograms, arrows indicate the nucleotide substitution in heterozygous subjects as shown by the presence of the 2 superimposed peaks representing the normal and abnormal base. A) SSCP analysis of the 5' regulatory region of p66 locus (T/T subjects with wild-type sequence, T/C subjects heterozygous for the variant). B) SSCP analysis of the CH2 region: the 92C>T substitution consisted in an amino acid substitution P31L (C/C subjects with wild-type sequence, C/T subject heterozygous for the variant).

Mutation detection with SSCP and sequence electropherograms of p66. PCR-SSCP and sequence analysis of the regulatory region of p66Shc locus (A) and of the p66Shc specific region CH2 (B). In the sequence electropherograms, arrows indicate the nucleotide substitution in heterozygous subjects as shown by the presence of the 2 superimposed peaks representing the normal and abnormal base. A) SSCP analysis of the 5' regulatory region of p66 locus (T/T subjects with wild-type sequence, T/C subjects heterozygous for the variant). B) SSCP analysis of the CH2 region: the 92C>T substitution consisted in an amino acid substitution P31L (C/C subjects with wild-type sequence, C/T subject heterozygous for the variant).

Discussion

We screened for new DNA polymorphisms the p66 specific region of the Shc locus (CH2) and the p66Shc promoter. We identified by PCR-SSCP assay of 1167 base pairs in 4 amplified segments two segregating sites in 2 out of the 342 chromosomes examined. The two novel variants (-354T>C and 92C>T) were very rare in both populations of CAD and elderly subjects. Furthermore, no subject homozygous for the two SNPs was found. Our observations agree with a previous study performed in a sample of extreme survivors of the Leiden 85-plus Study, where no sequence variations in the p66 specific region of the Shc gene were found [13]. The Shc gene contains one known non-synonymous polymorphism located in the CH1 domain which corresponds to Met300Val in the p52 isoform and to Met410Val in the p66 isoform [13]. No association of the Met300Val (the p52 isoform) variation was found with birth weight and length, impaired insulin secretion, insulin resistance and type 2 Diabetes Mellitus in a cohort of 360 young healthy Danish Caucasian subjects [14]. In a more recent study the Met410Val variant (the p66 isoform) was tested for association with longevity using a prospective follow-up design in two independent cohorts of 730 and 563 subjects aged 85 and over [13]. Mooijaart and co-workers observed a small increase in Val allele with increasing age of death and a decreased mortality risk of Met/Val carriers compared to Met/Met carriers; however no statistical significance was reached in the two different analyses [13]. These results suggest a possible beneficial effect of the Valine allele on longevity, but no subject homozygous for valine was found and the frequency of this allele was very low in this cohort. To date, no functional studies on the Met/Val variant of the p66Shc isoform have been performed. Finally, this Met/Val amino acid variant is present in all 3 isoform of the Shc gene, thus suggesting that this polymorphism is unlikely to specifically affect the function of p66Shc and not of p46Shc and p52Shc. For all these reasons we did not study the Met/Val variant in our cohorts, since we were looking for variants that would affect particularly the p66Shc gene.

Conclusion

Longevity is a complex trait, resulting from the interaction between multiple genetic and environmental factors. Before our, several studies in long-lived subjects have highlighted the role of biological factors as determinant of 'successful ageing'. For example associations between successful ageing and paraoxonase 1 (PON1) and interleukin 10 (IL-10) gene polymorphisms have been reported in centenarian [15-17]. However, confirmatory data is needed, and probably several other genetic factors are involved. In our study we had hypothesised that the p66Shc gene may play a pivotal role in controlling oxidative stress and vascular dysfunction in vivo, possibly regulating the evolution of the atherosclerotic process. In view of its association with CAD in animal models, we assumed that sequence variations would be less frequent in elderly survivors compared to younger CAD subjects. We screened for new DNA polymorphisms the p66 specific region of the Shc locus (CH2) and the p66Shc promoter and identified two very rare novel variants with no subject homozygous for these SNPs. Our observations agree with a previous study where no sequence variations in the p66 specific region of the Shc gene were found [13]. In the rest of the Shc gene, only one nucleotide substitution (Met/Val) has been reported, located in the CH1 domain and common to all three isoforms of the Shc gene [13,14]. These observations, together with our data, suggest that important variations in the Shc gene may not be tolerated and that evolution might have selected against their occurrence, and it appears that the role of p66Shc gene in mammalian longevity is probably more complex than previously thought.

Methods

Subjects selection

The p66 specific region of the Shc locus and the p66Shc promoter were screened for new sequence variants in 78 subjects with early-onset coronary disease (<55 years, mean age 48.5 ± 6 year) recruited among subjects undergoing coronary angioplasty or presenting with clear evidence of CAD (previous diagnosis of MI, or one or more stenoses greater than 50% in at least one major coronary artery after coronary catheterisation and clinical symptoms of angina). Diagnosis of MI was based on typical electrocardiographic changes and elevation of at least two enzymes, and was confirmed by the presence of wall motion abnormalities in left ventriculography. Control subjects were 93 unrelated long-living subjects (mean age 89 ± 6years) randomly selected from a population of individuals screened for CAD risk factors. Exclusion criteria were: 1) the presence of CAD 2) the presence of type 2 diabetes. CAD was excluded by use of the Rose questionnaire [18] and ECG (Minnesota coding). A complete medical history in all subjects was obtained by questionnaire. History taking included questions about smoking habits, history of hypertension and type 2 diabetes and current medications. Diagnosis of type 2 diabetes was based on history of hypoglycaemic treatment and/or confirmed fasting blood glucose >126 mg/dl (7.0 mmol/L). All Caucasian subjects were recruited in the Centre-West Coast of Italy, most from Rome and its surrounding towns. All subjects gave their written informed consent to their participation to the study. The study was approved by the University of Rome "La Sapienza" Ethical Committee.

Molecular genetic screening

Sequence variants of the p66Shc gene were analyzed with the PCR-SSCP technique as previously described [19]. Briefly, primers were designed to include the specific amino terminal region (CH2) of the p66 protein and the p66Shc promoter in order to evaluate possible mutations and to yield PCR fragments of 200–350 bp (Table 1). After PCR amplification, DNA fragments were electrophoresed in 1X MDE gel (FMC BioProducts, USA), and visualized with silver staining. All amplicons not showing SSCP variants with this method were electrophoresed in a 12% polyacrylamide gel in 1X TBE buffer and run at room temperature at a constant 25 mA for 14–16 h, with and without 5% glycerol. All SSCP variants were investigated by direct sequencing using the PRISM Dye Terminator Cycle Sequencing kit and an ABI 310 automated sequencer (Applied Biosystems) according to the manufacturer's instructions.
Table 1

Primers for PCR-SSCP analysis of p66Shc gene

AmpliconProduct size (bp)Forward primer (5'-)Reverse primer (5'-)
CH2352gcccctctttcacctcaactatgtcctggaggaggggtag
Promoter-1238cagagaagaggctccacgttggggcaggagatccatagtt
Promoter-2247cccacccccactttacttctaacgtggagcctcctctctg
Promoter-3330aggacaggaagggaaatgctagtgctgactcacaggctca

Forward and reverse primer sequences are all 5'. Promoter-1 fragment starts at nucleotide -222 from start codon of exon1; Promoter-2 fragment starts at nucleotide -449 from start codon of exon1; Promoter-3 fragment starts at nucleotide -637 from start codon of exon1 of p66Shc gene.

Primers for PCR-SSCP analysis of p66Shc gene Forward and reverse primer sequences are all 5'. Promoter-1 fragment starts at nucleotide -222 from start codon of exon1; Promoter-2 fragment starts at nucleotide -449 from start codon of exon1; Promoter-3 fragment starts at nucleotide -637 from start codon of exon1 of p66Shc gene.

Abbreviations

SSCP, single-strand conformational polymorphism; CH2, collagen-like domain at the amino-terminus; MI, myocardial infarction, CAD, coronary artery disease; SNP, single nucleotide polymorphism.

Authors' contributions

The studies were designed by FS and MGB. All subjects data were obtained by AB, FB, MF and the database organization was carried out by SR and MF. Experimental data was obtained by FS and EF. Data analyses were performed by FS and MGB. The paper was written by FS and MGB and all authors read and approved the final manuscript.
  19 in total

1.  Opposite effects of interleukin 10 common gene polymorphisms in cardiovascular diseases and in successful ageing: genetic background of male centenarians is protective against coronary heart disease.

Authors:  D Lio; G Candore; A Crivello; L Scola; G Colonna-Romano; L Cavallone; E Hoffmann; M Caruso; F Licastro; C M Caldarera; A Branzi; C Franceschi; C Caruso
Journal:  J Med Genet       Date:  2004-10       Impact factor: 6.318

2.  Opposite effects of the p52shc/p46shc and p66shc splicing isoforms on the EGF receptor-MAP kinase-fos signalling pathway.

Authors:  E Migliaccio; S Mele; A E Salcini; G Pelicci; K M Lai; G Superti-Furga; T Pawson; P P Di Fiore; L Lanfrancone; P G Pelicci
Journal:  EMBO J       Date:  1997-02-17       Impact factor: 11.598

3.  Reactive oxygen species as mediators of signal transduction in cardiovascular disease.

Authors:  J Abe; B C Berk
Journal:  Trends Cardiovasc Med       Date:  1998-02       Impact factor: 6.677

4.  The p66Shc longevity gene is silenced through epigenetic modifications of an alternative promoter.

Authors:  Andrea Ventura; Lucilla Luzi; Sonia Pacini; Cosima T Baldari; Pier Giuseppe Pelicci
Journal:  J Biol Chem       Date:  2002-04-10       Impact factor: 5.157

5.  Cardiovascular disease delay in centenarian offspring: role of heat shock proteins.

Authors:  Dellara F Terry; Maegan McCormick; Stacy Andersen; Jaemi Pennington; Emily Schoenhofen; Elizabeth Palaima; Maria Bausero; Kishiko Ogawa; Thomas T Perls; Alexzander Asea
Journal:  Ann N Y Acad Sci       Date:  2004-06       Impact factor: 5.691

6.  Paraoxonase polymorphisms PON1 192 and 55 and longevity in Italian centenarians and Irish nonagenarians. A pooled analysis.

Authors:  Irene M Rea; Pascal P McKeown; Dorothy McMaster; Ian S Young; Chris Patterson; Maurice J Savage; Christine Belton; Francesca Marchegiani; Fabiola Olivieri; Massimiliano Bonafe; Claudio Franceschi
Journal:  Exp Gerontol       Date:  2004-04       Impact factor: 4.032

7.  p66ShcA modulates tissue response to hindlimb ischemia.

Authors:  Germana Zaccagnini; Fabio Martelli; Pasquale Fasanaro; Alessandra Magenta; Carlo Gaetano; Anna Di Carlo; Paolo Biglioli; Marco Giorgio; Ines Martin-Padura; Pier Giuseppe Pelicci; Maurizio C Capogrossi
Journal:  Circulation       Date:  2004-06-01       Impact factor: 29.690

8.  Genetic susceptibility to death from coronary heart disease in a study of twins.

Authors:  M E Marenberg; N Risch; L F Berkman; B Floderus; U de Faire
Journal:  N Engl J Med       Date:  1994-04-14       Impact factor: 91.245

9.  Variation in the SHC1 gene and longevity in humans.

Authors:  Simon P Mooijaart; Diana van Heemst; Jeroen Schreuder; Suzan van Gerwen; Marian Beekman; Bernd W Brandt; P Eline Slagboom; Rudi G J Westendorp
Journal:  Exp Gerontol       Date:  2004-02       Impact factor: 4.032

10.  Genetic deletion of the p66Shc adaptor protein protects from angiotensin II-induced myocardial damage.

Authors:  Gallia Graiani; Costanza Lagrasta; Enrica Migliaccio; Frank Spillmann; Marco Meloni; Paolo Madeddu; Federico Quaini; Ines Martin Padura; Luisa Lanfrancone; PierGiuseppe Pelicci; Costanza Emanueli
Journal:  Hypertension       Date:  2005-07-05       Impact factor: 10.190

View more
  1 in total

Review 1.  Genetic Variations on Redox Control in Cardiometabolic Diseases: The Role of Nrf2.

Authors:  Cecilia Zazueta; Alexis Paulina Jimenez-Uribe; José Pedraza-Chaverri; Mabel Buelna-Chontal
Journal:  Antioxidants (Basel)       Date:  2022-03-06
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.