Literature DB >> 16507670

Controlled loading of oligodeoxyribonucleotide monolayers onto unoxidized crystalline silicon; fluorescence-based determination of the surface coverage and of the hybridization efficiency; parallel imaging of the process by Atomic Force Microscopy.

Fabrizio Cattaruzza1, Antonio Cricenti, Alberto Flamini, Marco Girasole, Giovanni Longo, Tommaso Prosperi, Giuseppina Andreano, Luciano Cellai, Emanuele Chirivino.   

Abstract

Unoxidized crystalline silicon, characterized by high purity, high homogeneity, sturdiness and an atomically flat surface, offers many advantages for the construction of electronic miniaturized biosensor arrays upon attachment of biomolecules (DNA, proteins or small organic compounds). This allows to study the incidence of molecular interactions through the simultaneous analysis, within a single experiment, of a number of samples containing small quantities of potential targets, in the presence of thousands of variables. A simple, accurate and robust methodology was established and is here presented, for the assembling of DNA sensors on the unoxidized, crystalline Si(100) surface, by loading controlled amounts of a monolayer DNA-probe through a two-step procedure. At first a monolayer of a spacer molecule, such as 10-undecynoic acid, was deposited, under optimized conditions, via controlled cathodic electrografting, then a synthetic DNA-probe was anchored to it, through amidation in aqueous solution. The surface coverage of several DNA-probes and the control of their efficiency in recognizing a complementary target-DNA upon hybridization were evaluated by fluorescence measurements. The whole process was also monitored in parallel by Atomic Force Microscopy (AFM).

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16507670      PMCID: PMC1385995          DOI: 10.1093/nar/gnj034

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


INTRODUCTION

Unoxidized crystalline silicon is considered the support of choice in nanobiotechnology (1), due to the uniformity and homogeneity of its surface at the nanometer scale (2,3) (). However, numerous other materials, such as gold (4–22), glass (23–32), quartz (33–36), metal oxides (37), oxidized silicon (38–44), organic polymers (45–50), harbouring oligodeoxyribonucleotides (ODNs) as probes, have been much more considered for the preparation of biosensors. Related publications are, in fact, relatively few (3,51–56) and do not adequately address the following fundamental issues. First, the formation of the layer was performed through several steps in most reported cases (51–54,56), one step being an alkaline hydrolysis (52,54), which inevitably damages the silicon surface (51). Second, the quality of the cross-linking layer, spacing out the silicon surface and supporting the ODN, was controlled and optimized only in a few cases (53,56), although this feature critically influences reproducibility in using the resulting materials (3,24,28,35,41,50). Third, the probe concentration on the surface was usually not quantified, even though it is well-known that this concentration should be kept below a limiting value: 2 × 1012 strands/cm2 according to some reports (5,16,17,22), or 4–6 × 1012 strands/cm2 according to other reports (4,10,11), for attaining the maximum hybridization efficiency and thus for attaining the maximum sensitivity and selectivity; in fact only the hybridized target-ODN concentration was commonly reported (51–53). Fourth, the accuracy of this latter determination, achieved by solid-state fluorescence microscopy (51,52) and by electrochemistry with an external probe (53), was rather low so that the authors themselves write of ‘approximate, rough values’. In this work we present our contribution, outlined in Scheme 1, addressing the four points cited above: as reported previously (57), we have functionalized unoxidized crystalline silicon with 10-undecynoic acid (SiCOOH) in a single step procedure, obtaining a controlled monolayer of the acid. On this surface we have anchored a fluorescent-ssODN, verifying the loading upon digestion with a DNase. Alternatively, this anchored ODN was considered as a probe and hybridized with a complementary, fluorescent-ssODN, which, after repeated washing, was subsequently freed through denaturation and measured. The ODN linked on the surface was then, digested and evaluated as before, to estimate the hybridization efficiency. The whole process was monitored in parallel by Atomic Force Microscopy (AFM).
Scheme 1

Overall procedure.

MATERIALS AND METHODS

1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDAC) and N-hydroxy succinimide (NHS) were from Fluka and used as received. All reagents used for preparing buffer solutions and Phosphodiesterase I from Crotalus adamanteus were from Sigma. Standard commercial reagents required for ODNs synthesis, including 3′-Amino-ON CPG columns and 5′-(6-FAM)-Fluorescein phosphoramidite were from Proligo Biochemie and Link Technologies. All ODNs were prepared on a Perseptive Biosystems Expedite 8909 automatic DNA synthesizer, using standard phosphoramidite chemistry. High-performance liquid chromatography (HPLC) was performed using a Perkin-Elmer Series 410 Bio LC pump system equipped with a Perkin-Elmer 235C Diode Array. The absorption spectra of ODNs were recorded with a Perkin-Elmer Lambda Bio 40 spectrophotometer. The concentration of the ODNs is expressed in 10−6 mol/l U (µM). Fluorescence measurements in solution were carried out on a Perkin-Elmer MPF-44B spectrometer. For AFM investigations, a homemade apparatus was used, as described elsewhere (58).

Silicon surface activation and functionalization with 10-undecynoic acid

Single-side polished n-Si wafers (from Siltronix, phosphorus-doped, 0.1–0.01 Ω cm resistivity, (100) orientation, 1 inch diameter, 500 µm thickness) were first washed in boiling 1,1,2-trichloroethene for 10 min and subsequently in methanol at room temperature, with sonication for 5 min. They were then oxidized in H2O2 (30%)/HCl (37%)/H2O (2:1:8) at 80°C for 15 min, repeatedly rinsed with water, etched with 10% aqueous HF for 10 min, rinsed with water again, dried through a stream of N2 and immediately closed in a dry-box to undergo the functionalization process. The functionalization with 10-undecynoic acid was performed via cathodic electrografting (CEG), according to the procedure reported previously (57). In details, this CEG process was carried out at constant intensity current (0.6 mA) in a two compartment polyethylene cell. The working electrode was the silicon wafer with 1.5 cm2 exposed area, in a CH3CN solution (3.5 ml) of 10-undecynoic acid 0.1 M and tetraethylammonium perchlorate (TEAP) 0.1 M as the supporting electrolyte. An ohmic contact on the rear side of the silicon was established after scratching the surface, rubbing it with Ga-In eutectic and attaching a copper contact to it. The electrode set-up was obtained by pressing the silicon wafer against an O-ring sealing a calibrated hole in the bottom of the cell. The counter electrode was a Pt-coil in a 3 ml solution of TEAP 0.1 M in CH3CN, filling a glass tube separated from the working compartment by a glass sintered disc (porosity 3). Several samples were prepared varying the total amount of faradaic charge (Q), passed during CEG.

Preparation of ODNs

The ODNs (Table 1, 1–8) were prepared at the 1 µmol scale and, having used Tac-protected dC (Proligo), were cleaved from the solid support by a mixture of ammonia and methylamine (AMA, Beckmann) in 10 min at room temperature, then the solution was heated for 10 min at 55°C. After removing AMA by rotating evaporation under vacuum (Speed Vac, Savant), the samples were dissolved in triethylammonium acetate 0.1 M (pH 7.0) buffer (TEAA) and purified on an HPLC column Vydac C18, 300 Å, 5µ, 50 × 22 mm, eluted at a flow-rate of 6 ml/min with a linear gradient 3–45% MeCN in TEAA 0.1 M (pH 7.0), in 20 min. The ODNs were further purified by HPLC on a SAX Dionex Nucleopack100, 250 × 22 mm column, with a slightly concave gradient 10–30% of NaClO4 0.5 M in Tris–HCl 25 mM buffer (pH 8), in 15 min, at a flow-rate 9.0 ml/min, then lyophilized and desalted on the Vydac column as above, but replacing TEAA with water. The ODNs were analysed on a SAX Dionex Nucleopack100, 250 × 4 mm column, with the same gradient as above, at a flow-rate 1.5 ml/min. The ssODNs were also analysed by PAGE on 15% polyacrylamide, 7 M urea gels (1 mm), containing 50 mM Tris–borate (pH 8.0), 0.1 mM EDTA buffer (Sigma), staining with ethidium bromide. The dsODNs were analysed both by HPLC and PAGE under analogous conditions as above, but omitting urea in PAGE.
Table 1

List of oligodeoxynucleotides

1 Fluorescein-5′-dA20-3′-Hexyl-NH2
2 Fluorescein-5′-dT20-3′-Hexyl-NH2
3 Fluorescein-5′-dA20-3′
4 Fluorescein-5′-dT20-3′
5 Fluorescein-5′-d(GCCTGGCTAGGTGACGAGCT)-3′-Hexyl-NH2
6 Fluorescein-5′-d(AGCTCGTCACCTAGCCAGGC)-3′
7 Fluorescein-5′-d(GCATCATACGATATCCATGACGAGTGACCGTCGAGAGGTCACACGAGTCTG)-3′-Hexyl-NH2
8 Fluorescein-5′-d(GTCATGGATATCGTATGATGC)-3′

Immobilization of ODNs

Unoxidized, crystalline silicon samples, pre-functionalized with undecynoic acid, were immersed in 4 ml phosphate buffer [Na2HPO4/NaH2PO4 (pH 6.84)] containing variable concentration of ODN (ca. 30–0.5 µM), EDAC 0.026 M and NHS 0.0017 M and let react overnight at room temperature. Afterwards, the solution was removed and silicon was cleaned by sonicating two times for 20 min with phosphate buffer and two times for 20 min with NaH2PO4 20 mM, NaCl 300 mM, EDTA 2 mM, SDS 7 mM (SPPE) and then rinsed thoroughly with SPPE at 60°C until the discarded solution was no longer fluorescent. The incubation time proved suitable to attain the thermodynamic equilibrium of the loading on to the SiCOOH substrate. ODN 2 was chosen as test-probe; different surface loading values were obtained depending on the ODN concentration in solution (Table 2). The other ODNs used as probes (1,5,7) were anchored after selecting the appropriate conditions, based on the results for ODN 2 (see below).
Table 2

Density of the ODN-probe 2 immobilized on the silicon surface (1.5 cm2 exposed area) as function of its concentration in solutiona

ODN concentration in solution (µM)ODN density on silicon surface (1012 strands/cm2)Hybridization efficiency %b
27.1358.1040
13.5679.4473
2.7146.5492
0.5435.64100
0.1352.09100

aReaction conditions: 4 ml phosphate buffer plus EDAC 0.026 M and NHS 0.0017 M; overnight; room temperature.

bAfter hybridization, denaturation and fluorescence measurements in solution (see text).

Fluorescence measurement calibration

The concentration of the ODNs in solution was calculated using the extinction coefficient derived from the Oligonucletide Properties Calculator (), assuming that the presence of the linker arm does not influence the ODNs optical properties. Given the fact that the fluorescence quantum yield of fluorescein is dependent on the substrate to which it is bound (59), then the corresponding fluorescence calibration plot was determined for each fluorescein-labelled ODN used in this study (Table 1, 1–8). Fluorescence intensity (λex = 492 nm, λem = 520 nm) was measured twice on five samples at concentrations in the range 0.5–6.0 × 10−9 M, prepared from 10−4 M stock solutions of each ODN, either in the digestion buffer (Tris–HCl), after digestion of the ODN with Phosphodiesterase I (1,2,5,7), or in 7 M urea (3,4,6,8), i.e. the expected solution composition and range of measurement. Two typical, slightly different trends, namely of ODN 2 and 3, in Tris–HCl buffer after enzymatic digestion and 7 M urea, respectively, are reported here (Figure 1). They are both linear, expressed by the equations 1.10 + 7.34(x) and 2.96 + 6.55(x), with associated correlation indexes 0.9744 and 0.9933, resulted by application of least-squares fitting, including the origin as an experimental point. Using these calibration plots, the approximation on fluorescein determination is ca. 0.10 × 10−9 M, and thus the limit of detection (LOD) of fluorescein in solution is ca. 0.30 × 10−9 M, equivalent to 1.2 × 10−12 mol, for a measurement volume of 4 ml. By considering that such two-dimensional ODN-monolayers, fully covering the planar support, have a density of 6 × 10−11 mol/cm2 (60), this method allows to detect a submonolayer lower than 2.0%, provided that the area of the functionalized silicon surface is ≥ 1.0 cm2 and the volume of the solution is ≤4 ml. The calibration plot equations for the other cases are the following: 0.87 + 9.82(x), 3.28 + 7.59(x), −0.60 + 1.77(x) and −2.72 + 7.20(x) for ODN 1, 2, 5 and 7 in Tris–HCL buffer; 2.53 + 9.95(x), 0.32 + 2.64(x) and −2.34 + 10.13(x) for ODN 1, 5 and 7 in the same buffer but after the enzymatic digestion; −0.422 +1.01(x), 2.10 + 4.34(x) and 1.37 + 5.32(x) for ODN 4, 6 and 8 in urea 7 M.
Figure 1

Dependence of the maximum intensity emission (λem = 520 nm, λex = 492 nm) of ODN 2 Fluorescein-5′-dT20-3′-Hexyl-NH2 on its concentration in Tris–HCl buffer after digestion with Phosphodiesterase I (straight line, closed circle) and of 1 ODN Fluorescein-5′-dA20-3′ in urea 7 M (dashed line, closed inverted triangle).

Evaluation of the anchored ODNs

The enzymatic degradation of the probe-ODNs present on the silicon surface was accomplished by immersing the sample in 4 ml of KH2PO4 10 mM, 10 mM MgCl2-6H2O (pH 7.0), adding 4 mU of Phosphodiesterase I, leaving for 6–24 h at 40°C, following digestion kinetics up to apparent completion through fluorescence measurements. The results for ODN 2 are reported in Figure 2.
Figure 2

Solution fluorescence intensity versus time, during the enzymatic digestion of an amino-terminated oligonucleotide (2) immobilized on the silicon surface.

Tm measurements

The ability to hybridize of the free, modified complementary ssODNs (1 + 4, 2 + 3, 5 + 6 and 7 + 8) was monitored by heating the appropriate equimolar mixtures (2.7–0.9 µM) in NaH2PO4 10 mM, NaCl 100 mM, EDTA 0.1 mM (pH 7.2), at 95°C for 2 min and allowing them to reach slowly r.t. Thermal denaturation curves were then obtained by monitoring the absorbance of the pre-hybridized ODNs at 260 nm as a function of temperature with a Perkin-Elmer 330 spectrometer, equipped with a Peltier temperature control accessory, in a stoppered 1 cm path length couvette. A ramp rate of 1°C/min with a hold time of 1 min was used over the range 25–85°C. Tm values of 44.6°C for both 1 + 4 and 2 + 3, and 66.9°C for 5 + 6 were estimated from the inflection points of the curves obtained by plotting the collected data of absorbance versus temperature. The hybrid 7 + 8 did not show any definite inflection point, although producing a continuous increase of absorbance upon heating.

Evaluation of on-surface hybridization

The surface, derivatized with either 1, 2, 5 or 7 ODN, was immersed into 4 ml of ca. 10 µM hybridization solution of 4, 3, 6 or 8, respectively. The system was then heated at 90°C for 5 min, slowly let cool down to room temperature, and left for 1 h at 5°C. Afterwards the solution was removed, the surface was repeatedly soaked into a solution of hybridization buffer and then two times for 5 min in SPPE at room temperature, until the discarded solution was no longer fluorescent, in order to remove all unbound ODN. Afterwards, denaturation of the hybrid was accomplished by immersing the sample in 4 ml of urea 7 M at 90°C, for 5 min. The solution was removed while still hot, cooled down to room temperature and analysed through fluorescence measurements. The repetition of the procedure produced no additional fluorescence. The sample was then addressed to the evaluation of ODN loading. Furthermore, the minimal amount of ODN-target in solution, which can be detected within the dynamic range accessible with this method, was determined. To this end, seven samples with immobilized ODN-probe 2 at almost the same surface density (5.64–5.87 × 1012 strands/cm2) were prepared and hybridized with the ODN-target 3 at a variable solution concentration (10.615–0.312 µM). The obtained results are reported in Table 3.
Table 3

Density of the ODN-target 3 hybridizeda with the ODN-probe 2 immobilized on the silicon surface of 1.5 cm2 exposed areab, as function of its concentration in solution

ODN concentration in solution (µM)ODN density on silicon surface (1012 strands/cm2)
10.6155.60
9.3695.63
3.1232.39
1.8742.82
1.6152.17
0.6252.39
0.3121.95

aReaction conditions: 4 ml hybridization buffer, at 90°C for 5 min and then at 5°C for 1 h (see Materials and Method).

bODN-probe 2 density on silicon surface for the various samples is nearly constant: 5.64–5.87 × 1012 strands/cm2.

AFM imaging

AFM images, were taken in different areas of every sample in order to characterize the quality of each step of the procedure, either in the contact or in the tapping mode and all samples resulted homogenous. The measurements were performed in air, at room temperature and constant 30% relative humidity. No noise filter was applied to the raw data which were treated by only a background subtraction and, when necessary, a plane alignment. In the contact mode, the microscope works in the weak repulsive regime, with interactions between tip and sample <1 nN, allowing high resolution imaging. The images of the 10-undecynoic acid layers were taken in this way. Moreover, the lateral scanning motion of the tip in the contact mode can be recorded through a lateral force (or friction force) modality that can give useful information regarding the chemical properties of the sample: different chemical properties usually imply different frictions between the sample and the scanning tip. In this case, the acquired information are qualitative and the corresponding cross section profile of the lateral force is expressed in arbitrary units (a.u.). On the other hand the contact mode operation implies forces that can produce a deformation of soft samples like ODNs on the surface. In extreme cases, the molecules could even be swept away from the surface and the particles could stick to the tip, thus damaging the sample and reducing the resolution of the measurement (61). Therefore, the ideal work regime for the analysis of the ODN covered samples is the intermittent contact mode AFM [Tapping mode AFM (62)]. In this modality, the tip oscillates on the sample with a mean interaction during a complete oscillation in the order of tens of pN, while the maximum interaction (still below 1 nN) is present only for a very small fraction of the time per oscillation and the lateral forces are strongly decreased. This allows a weak interaction with the sample, while maintaining a good lateral resolution, that depends on the choice of the tip in use. In this work we have selected two kind of tips: standard tips with a nominal apical radius of ca. 20 nm, which have been used for most AFM contact and tapping mode images, and ‘super-tips’ with a nominal apical radius of 1–2 nm, which were used to determine the influence of the tip apical radius in the determination of the lateral dimensions of the imaged ODN molecules. These ultra-sharp tips have the advantage of delivering a high resolution imaging, but are expected to introduce a larger deformation on the sample, since the same force applied on a smaller area produces a higher pressure.

RESULTS AND DISCUSSION

To produce a good DNA sensor, the device should display two specific relevant properties: (i) the cross-linking layer between the surface and the ODN (the undecynoic acid layer on silicon in our case) should be deposited as a uniform monolayer and (ii) the surface density of the immobilized ODN should be high enough to ensure the highest sensitivity in the molecular recognition event, but must not exceed a value above which steric hindrance in the formation of double strands on the surface becomes relevant (63). With regard to the first point, taking advantage of our previous studies (57), we attained a uniform monolayer modulating the faradaic charge during the CEG of the acid and controlling with AFM the resulting surfaces. Several samples were prepared varying the charge density from 1200 to 12 mC/cm2. With 1200 mC/cm2 the acid has deposited as multilayer, characterized by the presence of protrusions as high as 8–15 nm (Figure 3). With a 10-fold lower charge density, 120 mC/cm2, a uniform homogeneous monolayer was formed, with typical corrugation falling between 1 and 2 nm, distinctly above the value (0.3–0.4 nm) characteristic of the clean Si(100) surface, as we reported previously (57). Then, lower charge densities of 36 and 12 mC/cm2 were tested, in order to check whether the exposure of the silicon surface to the passage of a large charge, which can damage the surface, could be avoided. With 36 mC/cm2 a homogeneous monolayer was obtained, practically undistinguishable from that obtained with 120 mC/cm2. An AFM topographic image of a similar sample is presented and commented below. With 12 mC/cm2 the silicon surface resulted characterized by a lower typical corrugation (0.9 nm) and probably only partially and non uniformly functionalized, as shown in the topographic image (Figure 4A). In order to make this point clearer, the same area was also analysed in the friction force modality, showing the formation of round patches on the surface, that appear in correspondence (see the cross section profile) to properly functionalized zones (Figure 4B).
Figure 3

AFM contact mode topographic images (5 × 5 µm) of 10-undecynoic acid CEG deposited on Si(100) surface at high cathodic charge density (1200 mC/cm2), showing non-homogeneity and aggregation (A). The white bar indicates the analysed zone. The cross section profile (B) is measured along the bar.

Figure 4

(A) AFM contact mode and (B) friction force topographic images (2 × 2 µm) of 10-undecynoic acid CEG deposited on Si(100) surface with at 12 mC/cm2 cathodic charge density. The surface appears less homogeneous than as in well-covered monolayers. Round, so called ‘friction holes’ appear in the friction image, matching the higher areas in the contact mode topographic image. The white bar indicates the analysed zone. The corresponding cross section profiles, measured along the bar, are reported below, in (C and D), respectively.

It should be noted that, in all cases, the charge used in the CEG is in large excess with respect to the theoretical catalytic amount needed. In fact, the overall process is a redox reaction (≡Si-H + HCCR → ≡Si-C≡CR + H2), catalysed by the application of just a cathodic bias to the silicon surface, then a surface silyl anion is generated, which initiates a chain reaction (64). Evidently, in the chosen reaction conditions, the current efficiency of this electrocatalysed process is very low. Valuable information regarding the characterization of the 10-undecynoic acid monolayer, came from the analysis of a tapping mode AFM image of a sample prepared by CEG of 10-undecynoic acid at 36 mC/cm2, with the further deposition of ODN-probe 2 as explained below, which, however, resulted loaded in a very low amount (below the detection level by our methodology, i.e. <5 × 1011 strands/cm2). The analysis of the area reported in Figure 5 allowed to better evaluate the actual thickness of the acid monolayer, evidencing well distinguished functionalized and non-functionalized areas. The ODN molecules appear as rare, sparse, round structures present on the surface, uniformly functionalized with 10-undecynoic acid and non-modified by the ODN immobilization process. The non-functionalized scratch-like area is most probably originated by the presence of some debris on the silicon surface during the functionalization, that were then removed by the cleaning procedure performed after the CEG, leaving a clean non-functionalized area. In fact, a thorough analysis of the image shows that the surface has a corrugation of 1 nm outside the scratch and only 0.3 nm inside the scratch, thus confirming the different nature of the two areas: a functionalized crystalline silicon surface with a cleft-like non-functionalized scratch. The depth of the scratch is ca. 1.5 nm, compatible with the dimension of a single layer of 10-undecynoic acid molecules, as found by other authors, who, from an analogous AFM experiment concerning the grafting of methyl 10-undecenoate on Si(100) surface, reported a depth of a scratch, done on purpose in this case, of 1.1 nm (65).
Figure 5

AFM tapping mode topographic image (A) (6 × 6 µm) of 10-undecynoic acid CEG deposited on Si(100) surface at 36 mC/cm2 cathodic charge density and covered with a very low concentration of ssODN 2. The non-functionalized area allows to define as ca. 1.5 nm the height of the 10-undecynoic acid layer on the surface. The ODN molecules are represented as small round structures. The white bar indicates the analysed zone. The cross section profile (B) is measured along the bar. It should be noted that the scratch profile line is fairly smooth, and the local corrugation of the monolayer is consistent with the uniform monolayer.

Subsequently, all other ODN-probes were immobilized on substrates all prepared by CEG of 10-undecynoic acid at Q = 36 mC/cm2, starting with ODN 2. They were anchored on to the SiCOOH surface under near equilibrium conditions, using carbodiimide EDAC, R1N = C = NR2 mediated amidation in the presence of NHS as described in the literature (3,54,55). More precisely, this reaction involves several steps (), as outlined in Scheme 2. The carbodiimide is the promoter, which converts the acid into the O-acyl-urea intermediate (I); NHS is a catalyst that readily reacts with (I) affording the succinimidyl ester in situ (II); (II) is a well-known species, which has been detected on silicon surface with ATR-FTIR (55) and it has been also prepared and used ex situ in this process (3). The concentration of the immobilized ODN was then evaluated through enzymatic digestion with a DNase. To the best of our knowledge, this procedure was never applied before for a similar purpose. The only related reports (7,8) deal with the enzymatic removal of fluorescent ODNs, deposited as millimetre sized spots on gold surfaces, and detected by fluorescence microscopy. It was claimed that, the digestion is complete in 3 h, at room temperature, with 20 U of enzyme. We used a lower enzyme amount and verified the completeness of the digestion by measuring the fluorescence of the solution over time. Fluorescence increased asymptotically towards a limiting value (Figure 2) and the digestion was apparently almost complete in 6 h. Then, other experiments were performed varying the concentration of the ODN-probe in the solution in contact with the layer of 10-undecynoic acid, in order to assess the minimal concentration necessary for attaining an optimal surface functionalization, and the concentration of the ODN-target in the solution in contact with the anchored ODN in the hybridization process, in order to assess the lowest ODN-target concentration giving maximal response (100% hybridization) through this procedure. As shown in Table 2, an ODN-probe density of 5.64 × 1012 strands/cm2 can be considered optimal, and it resulted by reaction with probe-ODN at a concentration in solution 0.543 µM. The minimal ODN-target 3 concentration in solution, required for a 100% hybridization efficiency with ODN 2, was 9.369 µM (Table 3). The LOD, (assumed as three times the noise level) was determined by further lowering the ODN-target 3 concentration, and resulted 0.312 µM. Other experiments were carried out with ODN (1,5,7), bearing the aminohexyl group, as probes. The overall results are reported in Table 4. After immobilization on identical supports (type A in Scheme 1), the surface concentrations of the 20mers ODN 1 and 5, employing a solution concentration equal to the optimal value already established for 2 (0.54 µM), resulted (±ESD from three determinations) similar to each other and close to the optimal value found for ODN 2: 5.63 ± 0.15 and 5.93 ± 0.34 × 1012 strands/cm2, respectively. The 51mer 7 was used at concentrations in the solution in contact with the bound 10-undecynoic acid, up to 5.0 µM, but a surface concentration of only 1.97 ± 0.34 × 1012 strands/cm2 resulted attainable, which however is still in the optimal loading range, as discussed above, and proved able to hybridize efficiently (Table 4).
Table 4

Experimental data obtained with ODNs immobilized and hybridized on the silicon surface

SupportODN (probe)Concentration (µM)aReactantSurface ODN concentration (1012 strands/cm2)bODN (target)Surface hybridized ODN concentration (1012 strands/cm2)c
Si ⊢COOH10.54EDAC/NHS5.63 ± 0.1527.56 ± 0.28
Si ⊢COOH20.54EDAC/NHS5.64 ± 0.1515.64 ± 0.18
Si ⊢COOH50.54EDAC/NHS5.93 ± 0.3467.43 ± 0.80
Si ⊢COOH75.0EDAC/NHS1.97 ± 0.1682.78 ± 0.15
Si/SiO2 ⊢OH20.54EDAC/NHS0
Si ⊢COOH10.54EDAC/NHS0
Si ⊢COOH10.540
Si ⊢COOH30.54EDAC/NHS1.19 ± 0.1520
Si ⊢COOH1, 20.54EDAC/NHS5.60 ± 0.200
Si ⊢COOH20.54EDAC/NHS5.6060

aODN concentration in the loading solution.

bAfter enzymatic digestion and fluorescence measurement in solution.

cAfter denaturation and fluorescence measurement in solution.

Furthermore, we performed several control experiments to confirm that the overall procedure is robust and takes place mainly in the specific way outlined in Scheme 1. To this end, in order to check whether immobilization can occur through simple adsorption, or through reaction with internal moieties of ODNs possibly involved in carbodiimide chemistry, e.g. the exocyclic amino or terminal hydroxyl groups, as found by other authors on glass supports (66), we tested ODN with either the linker arm (1 and 2) or without it (3), under different conditions, on different supports: (i) HO-terminated oxidized silicon (Si/SiO2 ⊢OH) and 2 in the presence of EDAC/NHS; (ii) hydrogenated silicon (Si ⊢H) and 1 in the presence of EDAC/NHS; (iii) SiCOOH and 1 without EDAC/NHS; (iv) SiCOOH and 3 according to the standard, complete procedures. In experiment (iv), a small amount of ODN 3 proved to anchor on the surface, likely through the formation of amido bonds with its exocyclic amino groups, however it proved totally unable to hybridize. No control experiments other than (iv) with ODN 3 gave any detectable fluorescence signal, by operating with the ODNs at the optimal concentrations indicated above. In order to verify the stability of the anchored ODNs to such hybridization procedure, the same was applied to two samples loaded with either ODN 1 or 2, but without adding the respective complementary ODN, and no fluorescence was detected in any washing solution until Phosphodiesterase I was added. One further experiment was run in order to better evaluate the process of hybridization on the surface derivatized with probe-ODN 2, performing the whole hybridization procedure and using as target the non-complementary fluorescein-labelled ODN 6. No measurable fluorescence resulted other than in the washing solutions containing 6. To characterize the above preparations we report the tapping mode AFM imaging of a silicon sample covered first with 10-undecynoic acid (57) and then with ODN 1, prepared according to the optimized procedure, at a nominal density of 5.63 × 1012 strands/cm2, which displayed a homogeneous distribution of round structures (Figure 6; panels 1 and 2). A complication in determining the dimensions of these structures comes from the high packing of the layer, which results in a mean distance between adjacent ODNs around 5 nm. However, there are areas on the surface, where the intermolecular distance is statistically larger than the mean value allowing a simpler and reliable analysis. Following this strategy, we have focussed our efforts on these regions and measured a lateral dimension of ca. 18 nm and vertical height of ca. 3 nm.
Figure 6

Panel 1: AFM tapping mode topographic image (1 × 1 µm) of a Si(100) surface covered with a uniform layer of 10-undecynoic acid using a CEG procedure at 120 mC/cm2 cathodic charge density. The white bar indicates the analysed zone. The cross section evidences that the mean corrugation of the sample is around 1.3 nm. Panel 2: AFM tapping mode topographic image (1 × 1 µm) of a sample covered with 20mer ODN 1 (nominal density 5.63 × 1012 strands/cm2). The cross sections A and B show structures ca. 18 nm wide and ca. 3 nm high. The white bar indicates the analysed zone. The vertical heights, as measured along the bars, are reported in A and B. Panel 3: AFM tapping mode topographic image (1 × 1 µm) of a sample covered with a dsODN 1 + 4 (nominal density 5.63 × 1012 strands/cm2). The molecules appear as rod-like structures. Cross section A shows a structure ca. 20 nm wide and ca. 1.5 nm high. The height is lower than that of ssODN 1 (ca. 3 nm), probably due to a different orientation of the molecules on the surface. Cross section B, taken on a large agglomerate, can be deconstructed in three smaller structures with dimensions, shown by the fit curves, comparable with the dimensions of single molecules. The formation of large structures appears to be a side-effect of the hybridization process, as reported in the literature for similar samples (41). The white bar indicates the analysed zones. The cross section profiles as measured along the bar, without and with deconvolution of the profile, are reported in A and B, respectively.

Since the expected height of a 20mer ODN is slightly <7 nm (67), to understand the observed vertical dimensions of these structures one must take into account the mechanism of AFM imaging. The tip-sample interaction always produces a deformation of the sample. Ultra-soft molecules like ssODN can be considered as elastic rods (68), thus due to the probe-induced compression, their measured heights are lower than the expected molecule vertical dimensions. This effect is probably coupled with a non-vertical protrusion of the molecules over the surface, as predicted, for instance, for a 15mer ODN anchored on a flat gold surface, whose vertical height may change from 6.5 to 2.0 nm depending on the tilt angle formed between the normal to the surface and the vertical axis of the ODN (69). Indeed, the angular tilting of ODNs immobilized on gold, was recently investigated and it was supposed to be responsible of an apparent reduction of the observed ODN height: i.e. 3 nm instead of the predicted 16 nm for a completely elongated 25mer ODN (4). This could explain the low height values that we have measured. Regarding the lateral dimensions, the structures appear wider than the width of a ssODN, ca. 2 nm as theoretically calculated (70). However, the measured widths are closer to the theoretical value than most of those recently reported, regarding similar specimens analysed in analogous conditions (71–73). In fact, the AFM technique intrinsically produces images in which the structures are the convolution of the imaged object with the tip shape and this effect is particularly evident when the probe has an apical radius larger than the lateral dimensions of the structures under analysis. These anomalously large dimensions can be then, attributed to the broadening effect due to the tip-sample convolution. Hybridization trials were, then, carried out in triple on four different substrates (type B in Scheme 1), containing the probe-ODNs: Fluorescein-5′-dA20-3′-Hexyl-NH2 (1) or Fluorescein-5′-dT20-3′-Hexyl-NH2 (2), Fluorescein-5′-dX20-3′-Hexyl-NH2 (5) or Fluorescein-5′-dX51-3′-Hexyl-NH2 (7). In all four cases, high hybridization efficiency was obtained upon interaction with the corresponding complementary ODNs, prepared according to the optimized procedure: Fluorescein-5′-dT20 (4), Fluorescein-5′-dA20 (3), Fluorescein-5′-dX20 (6) and Fluoresceine-5′-dX24 (8), respectively, as resulted by the subsequent denaturation of the hybrids reported in Table 4. The anchored ODNs 1, 2, 5 and 7 were then finally digested with Phosphodiesterase I and their amounts were compared with those of the hybridized 3, 4, 6 and 8, resulting practically equivalent within the ESD. Nevertheless, the systematically higher values of the hybridized ODNs, with respect to the bound ODNs, may reflect a limited ability of the DNase to completely digest the ODNs anchored on the surface. Similarly as above, Figure 6; panel 3 shows the tapping mode AFM image of a typical ODN sample after hybridization (namely 1 + 4) using standard tips. The sample appears covered with small rod-like structures and some larger structures of various dimensions. The lateral dimensions of the smaller structures of the dsODNs on the surface result ca. 20 nm and their vertical dimensions ca. 1.5 nm (Cross section A of Figure 6; panel 3). The increase of the size observed for the dsODNs structures, compared to the analogous ss, can be attributed to the effect of hybridization. A similar size increase was already reported on similar samples, e.g. 16mer ODN-probes on oxidized silicon surface (41). The different vertical dimensions can be interpreted as consequence of the different tilting of the ODN with respect to the surface which could also justify their apparent greater mean lateral dimension. One of the larger structures shown in Figure 6; panel 3 displays an estimated width of ca. 80 nm and this can be attributed to an apparent aggregation of smaller dsODNs structures. This is shown in the cross section profile B of Figure 6; panel 3, where the large structure has been tentatively fitted as the aggregation of three smaller (ca. 20 nm) ones, whose dimensions are compatible with the single rod-like structures. With the aim to assess the convolution effect mentioned above, and to confirm our ability to detect single ssODNs, we also acquired some images using high resolution tips. These ‘super-tips’ have an apical radius of ca. 2 nm, thus the convolution has a much weaker impact on the lateral dimensions of the ODNs (74). In Figure 7; panel 1, we show a sample covered with a low density (nominal density ca. 1011 strands/cm2) of ODN 1. The use of this low ODN density determines a large (ca. 30 nm) mean space between the molecules. In this case the ssODN molecules appear as round structures with width of ca. 8 nm and height of ca. 1.8 nm. The different vertical dimensions are explainable considering that the same probe force generates an higher pressure when applied on a smaller interaction area, thus producing a larger deformation and possibly enhancing the angular tilt of the molecules on the surface. In both low and high resolution images, the surface between each structure is uniform and has a corrugation comparable with a clean silicon surface functionalized with 10-undecynoic acid.
Figure 7

Panel 1: AFM tapping mode topographic image (A), (250 × 250 nm) of a sample covered with a low concentration (nominal density ca. 1011 strands/cm2) of 20mer ODN 1, acquired by the use of super-tips (apical radius ca. 2 nm). The cross section shows a structure ca. 8 nm wide and ca. 1.8 nm high. The different lateral dimensions of these structures compared with the samples analysed with the standard tips (apical radius ca. 30 nm) illustrates the importance of the apical radius and form. The different vertical dimensions are probably the effect of the greater tip pressure due to the much smaller contact area. The white bar indicates the analysed zone. The cross section profile, as measured along the bar, is reported in (B). Panel 2: AFM tapping mode topographic image (A), (1 × 1 µm) of a sample covered with a very low concentration (nominal density around 1010 strands/cm2) of 20mer ODN 1. The low concentration allows to unequivocally analyse every single molecule. The white bar indicates the analysed zone. The cross section (B) shows that the structures are ca. 25 nm wide and ca. 2.5 nm high.

Furthermore we performed measurements using standard tips on another sample covered at a low nominal density, around 1010 strands/cm2 of the 20mer ODN 1. This was done in order to show that the features observed with the super-tips would appear with a larger lateral size if imaged using the standard tips. The use of such a low ODN density determines an even larger mean space between the molecules, allowing to undoubtedly discriminate the single molecules even using the standard tips. This is reported in Figure 7; panel 2. As a major consequence of the analogy of the observed dimensions we can claim that the structures are the same as observed in Figure 6; panel 2 (standard tip/high concentration). Thus, we demonstrated the single molecule sensitivity and obtained a state-of-the-art lateral resolution of 8.6 nm.

CONCLUSIONS

A simple, robust, accurate and optimized two-step procedure to functionalize unoxidized crystalline silicon, Si(100), with controlled amounts of ODNs is hereby reported. The samples produced through this procedure have been exploited as probe systems for DNA recognition. First, 10-undecynoic acid was covalently anchored on the silicon surface, via CEG, attaining a carboxylic acid terminated monolayer upon passage of 36 mC/cm2 charge density. Then, ssODNs were immobilized on this layer via amidation. The concentration of both ssODNs and dsODNs were determined through fluorescence measurements in solution. This procedure allowed us (i) to assess the optimal-probe density, for 20mer ODNs, on the surface (5–6 × 1012 strands/cm2), i.e. the maximum loading which yields a 100% hybridization efficiency and (ii) to determine the corresponding ODN-target LOD (0.312 µM). One longer (50mer) ODN tested, lead to lower loading, still maintaining however the ability to fully hybridize. AFM has proved a useful tool to characterize the whole procedure by parallel imaging. Samples prepared in this way, using crystalline silicon, are good candidates for the development of new, label-free, ultra-sensitive biosensor devices based on a change in electrical properties associated with biorecognition events occurring at their surface.
  40 in total

1.  Comparison between different strategies of covalent attachment of DNA to glass surfaces to build DNA microarrays.

Authors:  N Zammatteo; L Jeanmart; S Hamels; S Courtois; P Louette; L Hevesi; J Remacle
Journal:  Anal Biochem       Date:  2000-04-10       Impact factor: 3.365

2.  Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms.

Authors:  C Adessi; G Matton; G Ayala; G Turcatti; J J Mermod; P Mayer; E Kawashima
Journal:  Nucleic Acids Res       Date:  2000-10-15       Impact factor: 16.971

3.  The effect of surface probe density on DNA hybridization.

Authors:  A W Peterson; R J Heaton; R M Georgiadis
Journal:  Nucleic Acids Res       Date:  2001-12-15       Impact factor: 16.971

4.  Amplified detection of DNA and analysis of single-base mismatches by the catalyzed deposition of gold on Au-nanoparticles.

Authors:  Y Weizmann; F Patolsky; I Willner
Journal:  Analyst       Date:  2001-09       Impact factor: 4.616

5.  Hybridization of mismatched or partially matched DNA at surfaces.

Authors:  Alexander W Peterson; Lauren K Wolf; Rosina M Georgiadis
Journal:  J Am Chem Soc       Date:  2002-12-11       Impact factor: 15.419

6.  Light-directed 5'-->3' synthesis of complex oligonucleotide microarrays.

Authors:  Thomas J Albert; Jason Norton; Markus Ott; Todd Richmond; Kate Nuwaysir; Emile F Nuwaysir; Klaus-Peter Stengele; Roland D Green
Journal:  Nucleic Acids Res       Date:  2003-04-01       Impact factor: 16.971

7.  A fluorescence-based method for determining the surface coverage and hybridization efficiency of thiol-capped oligonucleotides bound to gold thin films and nanoparticles.

Authors:  L M Demers; C A Mirkin; R C Mucic; R A Reynolds; R L Letsinger; R Elghanian; G Viswanadham
Journal:  Anal Chem       Date:  2000-11-15       Impact factor: 6.986

8.  Attachment of benzaldehyde-modified oligodeoxynucleotide probes to semicarbazide-coated glass.

Authors:  M A Podyminogin; E A Lukhtanov; M W Reed
Journal:  Nucleic Acids Res       Date:  2001-12-15       Impact factor: 16.971

9.  Covalent attachment of oligodeoxyribonucleotides to amine-modified Si (001) surfaces.

Authors:  T Strother; R J Hamers; L M Smith
Journal:  Nucleic Acids Res       Date:  2000-09-15       Impact factor: 16.971

10.  High surface density immobilization of oligonucleotide on silicon.

Authors:  B A Cavic; M E McGovern; R Nisman; M Thompson
Journal:  Analyst       Date:  2001-04       Impact factor: 4.616

View more
  1 in total

1.  Controlling oligonucleotide surface density in light-directed DNA array fabrication.

Authors:  Siyuan Chen; Margaret F Phillips; Franco Cerrina; Lloyd M Smith
Journal:  Langmuir       Date:  2009-06-02       Impact factor: 3.882

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.