Literature DB >> 16485475

Pandemic strain of foot-and-mouth disease virus serotype O.

Nick J Knowles1, Alan R Samuel, Paul R Davies, Rebecca J Midgley, Jean-François Valarcher.   

Abstract

A particular genetic lineage of foot-and-mouth disease virus (FMDV) serotype O, which we have named the PanAsia strain, was responsible for an explosive pandemic in Asia and extended to parts of Africa and Europe from 1998 to 2001. In 2000 and 2001, this virus strain caused outbreaks in the Republic of Korea, Japan, Russia, Mongolia, South Africa, the United Kingdom, Republic of Ireland, France, and the Netherlands, countries which last experienced FMD outbreaks decades before (ranging from 1934 for Korea to 1984 for the Netherlands). Although the virus has been controlled in all of these normally FMD-free or sporadically infected countries, it appears to be established throughout much of southern Asia, with geographically separated lineages evolving independently. A pandemic such as this is a rare phenomenon but demonstrates the ability of newly emerging FMDV strains to spread rapidly throughout a wide region and invade countries previously free from the disease.

Entities:  

Mesh:

Year:  2005        PMID: 16485475      PMCID: PMC3367651          DOI: 10.3201/eid1112.050908

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Foot-and-mouth disease virus (FMDV, family Picornaviridae, genus Aphthovirus) causes an acute vesicular disease of pigs and wild and domesticated ruminants such as cattle, water buffalo, sheep, goats, and deer (). It can cause high death rates in young animals and production losses in adults and is considered to be the single most important constraint to world trade in live animals and animal products. Spread of FMDV is predominantly associated with the legal and illegal movement of infected animals or their products. The Food and Agriculture Organization World Reference Laboratory for Foot-and-Mouth Disease (WRLFMD) is established within the high-security laboratory at the Institute for Animal Health, Pirbright, United Kingdom (). From 2000 to 2004, WRLFMD received an annual average of 536 samples to diagnose FMD from regions of the world where the disease is endemic, predominantly Africa and Asia. Seven serotypes of FMDV exist: SAT 1, SAT 2, and SAT 3 are usually restricted to Africa; Asia 1 is restricted to Asia; and O, A, and C are present in Africa, Asia, and South America and occasionally Europe. In each of the last 5 years, serotype O has been isolated from >60% of the positive FMD samples received. The economic consequences of FMD incursion into disease-free regions may be severe. For instance, in the first 3 months of the 1997 outbreak in Taiwan, >6,000 farms were affected, 4 million pigs were destroyed or died from the disease, and >21 million doses of vaccine were used (). The cost of controlling the disease was estimated at US $378.6 million. An additional $1.6 billion was lost in export trade, and >65,000 jobs in pig farming and associated industries were lost (). To control the FMD outbreak without using vaccination, animals were slaughtered on >10,000 farms in the United Kingdom in 2001; only one fifth of these animals were actually infected. Four million animals were slaughtered for control measures and 2.5 million more for animal health reasons (). The direct and indirect losses were estimated at ≈£8 billion (). FMDV has a genome consisting of a single strand of positive-sense RNA. Consequently, the virus has a high mutation rate and may change, on a random basis, 1–8 nucleotides (nt) per replication cycle (). Nucleotide sequencing of part or all of the genome region coding for the outer capsid polypeptide VP1 was first used to study the epidemiology of FMD by Beck and Strohmaier (), who investigated the origin of outbreaks of types O and A in Europe over a 20-year period. Since then, genetic variability has been used to individually characterize strains of FMDV and track their movement across international borders (), and a large number of epidemiologic studies have been published (). Previously, on the basis of comparisons of partial VP1 sequences (≈170 nt at the 3´ end of the gene) of FMD type O viruses, differences between 2 isolates within 4% have been suggested to indicate a recent common origin, whereas differences of >15% signify geographic isolation over many years (), similar to the distinctions made between human polioviruses (). Isolates with >85% nt sequence identity have been placed within groups or topotypes, which tend to be restricted in their geographic distribution (,). The 10 topotypes have been named Europe-South America (Euro-SA), Middle East–South Asia (ME-SA), Southeast Asia (SEA), Cathay (CHY), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), East Africa 3 (EA-3), Indonesia-1 (ISA-1), and Indonesia-2 (ISA-2). The Indonesian topotypes, which have not been identified since 1983, are considered extinct. Knowles et al. () described the emergence and spread of the PanAsia strain from 1990 to 2000 on the basis of comparisons of partial (and some complete) VP1 sequences from 60 virus isolates. This article extends the molecular epidemiology of this virus strain by comparing 188 complete VP1 sequences for FMD type O viruses mostly isolated from 2000 to 2005 with published sequences of selected viruses from the previous decade and some reference virus strains (N = 151).

Materials and Methods

Viruses and Primers

The designation and origin of FMDV isolates studied are listed in Table A1.
Table A1

Designation and origin of food-and-mouth disease type O viruses studied. Download PDF (64 KB, 13 pages)

TopotypeStrainVirus designationGeographic originDateSpeciesDatabase
ME-SAPanAsiaO/AFG/16/2003Tashqurghan, Balkh, AfghanistanApr 10, 2003BovineDQ165035
ME-SAPanAsiaO/AFG/50/2003Center, Takhar, AfghanistanApr 14, 2003BovineDQ165036
ME-SAInd2001O/BAR/2/97Bahrain1997Not knownAJ318824†
ME-SAPanAsiaO/BAR/8/98Bahrain1998BovineAJ318825†
ME-SAPanAsiaO/BAR/6/99Bahrain1999BovineDQ164862†
ME-SAInd2001O/BAR/1/2001BahrainMay 2001BovineDQ164863†
ME-SAPanAsiaO/BHU/1/98Serbithang, BhutanFeb 8, 1998PorcineAJ318826†
ME-SAPanAsiaO/BHU/2/2002Bhutan2002Not knownDQ165037
ME-SAInd2001O/BHU/7/2002Bhutan2002Not knownDQ164864†
ME-SAPanAsiaO/BHU/38/2002Bumthang, BhutanJul 29, 2002BovineDQ165038
ME-SAPanAsiaO/BHU/15/2003Eastern Region, BhutanAug 6, 2003BovineDQ164865†
ME-SAPanAsiaO/BHU/22/2003Eastern Region, BhutanAug 16, 2003BovineDQ165039
ME-SAPanAsiaO/BHU/24/2003Southern Region, BhutanAug 16, 2003BovineDQ165040
ME-SAPanAsiaO/BHU/25/2003Southern Region, BhutanAug 16, 2003BovineDQ164866†
ME-SAPanAsiaO/BHU/41/2003West Central Region, BhutanOct 20, 2003BovineDQ165041
ME-SAPanAsiaO/BHU/47/2003Southern Region, BhutanDec 10, 2003BovineDQ165042
ME-SAPanAsiaO/BHU/49/2003Western Region, BhutanDec 31, 2003BovineDQ164867†
ME-SAPanAsiaO/BHU/26/2004Western Region, BhutanMar 2004BovineDQ165043
ME-SAPanAsiaO/BHU/27/2004Western Region, BhutanMar 2004BovineDQ164868†
ME-SAPanAsiaO/BHU/28/2004Western Region, BhutanMar 2004BovineDQ165044
ME-SAPanAsiaO/BHU/30/2004BhutanFeb 16, 2004BovineDQ165045
ME-SAPanAsiaO/BHU/31/2004BhutanFeb 16, 2004BovineDQ164869†
ME-SAPanAsiaO/BHU/33/2004BhutanFeb 27, 2004BovineDQ165046
ME-SAPanAsiaO/BHU/39/2004BhutanApr 7, 2004BovineDQ164870†
ME-SAPanAsiaO/BHU/40/2004BhutanApr 7, 2004BovineDQ165047
SEA-O/CAM/3/98Kg. Speu, Cambodia May 1, 1998BovineAJ294910
ME-SAPanAsiaO/CAM/2/2000Angkor Chum, Siem Reap, CambodiaJan 27, 2000BovineAJ318828†
ME-SAPanAsiaO/CAM/4/2000Angkor Chum, Siem Reap, CambodiaJan 29, 2000BovineAJ318829†
ME-SAPanAsiaO/Tibet/CHA/99Tibet, P.R. China1999BovineAJ539138
WA-O/CIV/8/99Côte d’Ivoire1999BovineAJ303485
ME-SA-O1/Sharquia/EGY/72Sharquia Governate, Egypt1972BovineDQ164871†
Euro-SA-O1/Kaufbeuren/FRG/66Kaufbeuren, Germany1966BovineX00871
ME-SAPanAsiaO/FRA/1/2001Mayenne, Pays de la Loire, FranceMar 2001Not knownDQ164872†
ME-SAPanAsiaO/FRA/1/2001Mayenne, Pays de la Loire, FranceMar 2001Not knownAJ633821
WA-O/GHA/5/93Kintampo, GhanaJan 6, 1993BovineAJ303488
WA-O/GNA/4/99Kawkan/Madina, GuineaMay 8, 1999BovineDQ165071
ME-SABranch AO/GRE/23/94Xanthi, GreeceAug 4, 1994BovineDQ164873†
ME-SAIran2001O/GRE/18/96Issakion, Didymotiho, Evros, GreeceJul 31, 1996ovineDQ164874†
Cathay-O/HKN/21/70Hang Tau, Sheung Shiu, N. T., Kowloon, Hong Kong Mar 13, 1970PorcineAJ294911
Cathay-O/HKN/6/83Pokfulam, Hong Kong Island Dec 18, 1982BovineAJ294919
Cathay-O/HKN/12/91Sek Kwu Chau, N.T., Kowloon, Hong Kong Nov 26, 1991PorcineAJ294921
Cathay-O/HKN/16/96Takwuling, N.T., Kowloon, Hong Kong Mar 29, 1996PorcineAJ294923
Cathay-O/HKN/20/96Hong Kong Apr 17, 1996BovineAJ294924
Cathay-O/HKN/1/99Mong Tseng Tsuen, Yuen Long, Hong KongJan 5, 1998PorcineAJ294925
Cathay-O/HKN/4/2001Hong Kong2001Not knownDQ164875†
Cathay-O/HKN/19/2001Sheun Shui, NT, Hong KongSep 28, 2001PorcineDQ164876†
Cathay-O/HKN/1/2002Yuen Long, New Territories, Hong KongJan 22, 2002PorcineDQ164877†
Cathay-O/HKN/3/2002Yuen Long, New Territories, Hong KongJan 31, 2002PorcineDQ164878†
Cathay-O/HKN/2/2003Hong Kong2003PorcineDQ164879†
Cathay-O/HKN/3/2003Hong Kong2003PorcineDQ164880†
Cathay-O/HKN/3/2004Hong KongJan 28, 2004PorcineDQ164881†
Cathay-O/HKN/4/2004Hong KongFeb 11, 2004PorcineDQ164882†
Cathay-O/HKN/6/2004Hong KongMar 2, 2004PorcineDQ164883†
Cathay-O/HKN/7/2004Hong KongMar 18, 2004PorcineDQ164884†
Cathay-O/HKN/8/2004Hong KongAug 11, 2004PorcineDQ164885†
Cathay-O/HKN/9/2004Hong KongAug 11, 2004PorcineDQ164886†
Cathay-O/HKN/10/2004Hong KongAug 11, 2004PorcineDQ164887†
Cathay-O/HKN/11/2004Hong KongAug 11, 2004PorcineDQ164888†
Cathay-O/HKN/12/2004Hong KongAug 11, 2004PorcineDQ164889†
ME-SA-O5/IND/1/62Thakurdwara, Moradabad, Uttar Pradesh, India1962Not knownDQ164890†
ME-SABranch BO5/IND/62Thakurdwara, Moradabad, Uttar Pradesh, India1962 Not knownAY593828
ME-SABranch BO5/IND/1/62Thakurdwara, Moradabad, Uttar Pradesh, India1962 Not knownRef. 16
ME-SABranch BO/IND/R2/75*Tamilnadu, India1975BovineAF204276
ME-SABranch AO/IND/53/79Tamilnadu, India1979BovineAF292107
ME-SABranch AO/IND/136/87*Guwahati, Assam, India1987BovineRef. 16
ME-SABranch AO/IND/4/88*Bareilly, Uttar Pradesh, India1988BovineRef. 16
ME-SAPanAsiaO/IND/231/88*Kheda, Gujarat, India1982BovineRef. 16
ME-SABranch AO/IND/8/89*Bangalore, Karnataka, India1989BovineRef. 16
ME-SAPanAsiaO/IND/6/90*Jallandhar, Punjab, India1990BovineRef. 16
ME-SABranch BO/IND/79/90*Jind, Haryana, India1988BovineRef. 16
ME-SABranch AO/IND/100/90*Jallandhar, Punjab, India1989PorcineRef. 16
ME-SAPanAsiaO/IND/232/90*Cuttack, Orissa, India1990BovineRef. 16
ME-SAPanAsiaO/IND/234/90*Cuttack, Orissa, India1990BovineRef. 16
ME-SAPanAsiaO/IND/235/90*Cuttack, Orissa, India1990BovineRef. 16
ME-SABranch AO/IND/7/94*Bangalore, Karnataka, India1993BovineRef. 16
ME-SAIran2001O/IND/27/95*Salem, Tamilnadu, India1994BovineRef. 16
ME-SAIran2001O/IND/52/95*Bhiwani, Haryana, India1995BovineRef. 16
ME-SAPanAsiaO/IND/50/96*Thane, Maharastra, India1990BovineRef. 16
ME-SAIran2001O/IND/162/97*Jalgaon, Maharastra, India1997BovineRef. 16
ME-SABranch C-IO/IND/279/97*Nagaon, Assam, India1997BovineRef. 16
ME-SAPanAsiaO/IND/289/97*Howrah, West Bengal, India1997BovineRef. 16
ME-SAInd2001O/IND/313/97*Hisar, Haryana, India1997BovineRef. 16
ME-SABranch AO/IND/489/97*Tamilnadu, India1984Not knownRef. 16
ME-SAPanAsiaO/IND/31/98*Jalpaiguri, West Bengal, India1997BovineRef. 16
ME-SAPanAsiaO/IND/146/98*Tumkur, Karnataka, India1998PorcineRef. 16
ME-SABranch C-IO/IND/413/98*Doddaballapura, Karnataka, India1998BovineRef. 16
ME-SAPanAsiaO/IND/429/98*Anantpur, Andhra Pradesh, India1998BovineRef. 16
ME-SABranch C-IO/IND/141/99*Thirunelveli, Tamilnadu, India1999BuffaloRef. 16
ME-SAPanAsiaO/IND/143/99*Agra, Uttar Pradesh, India1999BovineRef. 16
ME-SAPanAsiaO/IND/209/99*Ahmednagar, Maharashtra, India1998BovineRef. 16
ME-SAInd2001O/IND/246/99*Gujarat, India1999BovineRef. 16
ME-SAPanAsiaO/IND/5/00*Kurnool, Andhra Pradesh, India1999BovineRef. 16
ME-SAPanAsiaO/IND/30/00*Sirsa, Haryana, India1999BovineRef. 16
ME-SAPanAsiaO/IND/34/00*Hisar, Haryana, India2000BovineRef. 16
ME-SAPanAsiaO/IND/36/00*Sirsa, Haryana, India2000BovineRef. 16
ME-SAPanAsiaO/IND/43/00*Chitradurga, Karnataka, India1999BovineRef. 16
ME-SAPanAsiaO/IND/45/00*Doddaballapura, Karnataka, India1999BovineRef. 16
ME-SAPanAsiaO/IND/74/00*Hassan, Karnataka, India2000BovineRef. 16
ME-SAPanAsiaO/IND/75/00*Arakalgudu, Karnataka, India2000BovineRef. 16
ME-SAPanAsiaO/IND/77/00*Arakalgudu, Karnataka, India2000BovineRef. 16
ME-SAIran2001O/IND/90/00*Chitradurga, Karnataka, India2000BovineRef. 16
ME-SAPanAsiaO/IND/91/00*Chitradurga, Karnataka, India2000BovineRef. 16
ME-SAIran2001O/IND/111/00*Howrah, West Bengal, India1999BovineRef. 16
ME-SAPanAsiaO/IND/112/00*Nadia, West Bengal, India2000BovineRef. 16
ME-SAIran2001O/IND/151/00*Midnapore, West Bengal, India2000BovineRef. 16
ME-SAIran2001O/IND/156/00*Nadia, West Bengal, India2000BovineRef. 16
ME-SAIran2001O/IND/157/00*24 Parganas, West Bengal, India2000BovineRef. 16
ME-SAIran2001O/IND/398/00*Surendra Nagar, Gujarat, India2000Not knownRef. 16
ME-SAInd2001O/IND/402/00*Jam Nagar, Gujarat, India2000Not knownRef. 16
ME-SAIran2001O/IND/40/01*Midnapore, West Bengal, India2000BovineRef. 16
ME-SAInd2001O/IND/58/01*Mahadevpur, Karnataka, India2001BovineRef. 16
ME-SAInd2001O/IND/64/01*Muzaffarnagar, Uttar Pradesh, India2001BovineRef. 16
ME-SAPanAsiaO/IND/78/01*Hoshiarpur, Punjab, India2001BovineRef. 16
ME-SAPanAsiaO/IND/79/01*Hoshiarpur, Punjab, India2001BovineRef. 16
ME-SAInd2001O/IND/83/01*Mandya, Karnataka, India2001BovineRef. 16
ME-SAInd2001O/IND/86/01*Kolar, Karnataka, India2001BovineRef. 16
ME-SAInd2001O/IND/93/01*Kolar, Karnataka, India2001BovineRef. 16
ME-SAInd2001O/IND/96/01*Ludhiana, Punjab, India2001BuffaloRef. 16
ME-SAInd2001O/IND/97/01*Ambala, Haryana, India2001BovineRef. 16
ME-SAPanAsiaO/IND/102/01*Hatharas, Uttar Pradesh, India2001BuffaloRef. 16
ME-SAInd2001O/IND/106/01*Hisar, Haryana, India2001BovineRef. 16
ME-SAInd2001O/IND/111/01*Gurgaon, Haryana, India2001BovineRef. 16
ME-SAInd2001O/IND/112/01*Gurgaon, Haryana, India2001buffaloRef. 16
ME-SAPanAsiaO/IND/115/01*Kuruksetra, Haryana, India2001BovineRef. 16
ME-SAInd2001O/IND/116/01*Narnaul, Haryana, India2001BovineRef. 16
ME-SAInd2001O/IND/118/01*Jaipur, Rajasthan, India2001buffaloRef. 16
ME-SAInd2001O/IND/119/01*Karnal, Haryana, India2001BovineRef. 16
ME-SAInd2001O/IND/125/01*Faridabad, Haryana, India2001BovineRef. 16
ME-SAPanAsiaO/IND/136/01*Baruch, Gujarat, India2001BovineRef. 16
ME-SAPanAsiaO/IND/151/01*Kutch, Gujarat, India2001BovineRef. 16
ME-SAPanAsiaO/IND/155/01*Baruch, Gujarat, India2001BovineRef. 16
ISA-1-O/ISA/1/62Bali, IndonesiaJul 1962BovineAJ303500
ISA-2-O/JAV/5/72Java, Indonesia1972Not knownAJ303509
ISA-2-O/ISA/1/74Bali Quarantine Station, Indonesia1974BovineAJ303501
ISA-1-O/ISA/9/74Bali, IndonesiaOct 30, 1974BovineAJ303502
ISA-1-O/ISA/8/83East Java, Indonesia1983BovineAJ303503
ME-SAPanAsiaO/IRL/134/2001Louth, Republic of IrelandMar 20, 2001BovineDQ164891†
ME-SAPanAsiaO/IRN/9/99Iran1999Not knownAJ318838†
ME-SAPanAsiaO/IRN/24/99Iran1999Not knownAJ318839†
ME-SAPanAsiaO/IRN/1/2000Ghotil, West Azrarbijan, Mahabad, IranMay 6, 2000BovineDQ164892†
ME-SAPanAsiaO/IRN/16/2000Sardasht, W. Azerbaijan, IranJun 28, 2000BovineAJ318840†
ME-SAPanAsiaO/IRN/16/2001Shirin Abad, Markazy, IranJul 9, 2001BovineDQ164893†
ME-SAPanAsiaO/IRN/41/2001Oshnaveye, West Azar, IranNov 14, 2001BovineDQ164894†
ME-SAPanAsiaO/IRN/58/2001Dam Shahz, Qom, IranNov 29, 2001BovineDQ164895†
ME-SAIran2001O/IRN/61/2001Mynab, Hormozgan, IranDec 15, 2001BovineDQ164896†
ME-SAPanAsiaO/IRN/67/2001Zahedan, Systan, IranDec 22, 2001BovineDQ164897†
ME-SAPanAsiaO/IRN/2/2003Abaz Abad, West Azarbijan, IranJan 3, 2003BovineDQ165048
ME-SAIran2001O/IRN/4/2003Kahak, Qom, IranJan 4, 2003BovineDQ165049
ME-SAIran2001O/IRN/6/2003Hajiabad, Hormozgan, IranJan 9, 2003BovineDQ165050
ME-SAIran2001O/IRN/8/2003Sanandoj, Kordestan, IranJan 15, 2003BovineDQ165051
ME-SAIran2001O/IRN/15/2003Amol, Mazanderan, IranApr 13, 2003Not knownDQ164898†
ME-SAPanAsiaO/IRN/16/2003Gorgah, Golestan, IranApr 14, 2003BovineDQ165052
ME-SAPanAsiaO/IRN/6/2004Oshnavieh, W. Azerbaijan, IranJul 11, 2004BovineDQ165053
ME-SAPanAsiaO/IRN/8/2004Urmiah, W. Azarbaijan, IranAug 17, 2004BovineDQ165054
ME-SAIran2001O/IRN/15/2004Ardebil, Ardebil, IranOct 3, 2004BovineDQ165055
ME-SAIran2001O/IRN/20/2004Hosseinabad, Fars, Shiraz, IranOct 19, 2004BovineDQ165056
ME-SAPanAsiaO/IRQ/26/2000Erbil, IraqApr 9, 2000BovineAJ318841†
ME-SAPanAsiaO/IRQ/30/2000Erbil, IraqApr 9, 2000BovineDQ165057
ME-SA-O/Geshur/ISR/85Kibbutz Geshur, Galand, IsraelMay 1985BovineAF189157
ME-SA-O/ISR/2/88Dalton, Zefat, IsraelJun 24, 1988BovineDQ164899†
ME-SAPanAsiaO/ISR/2/2004Hadaron, IsraelJan 20, 2004BovineDQ164900†
ME-SAPanAsiaO/ISR/3/2004Hadaron, IsraelJan 22, 2004BovineDQ164901†
ME-SAPanAsiaO/ISR/4/2004Hazafon, IsraelJan 23, 2004BovineDQ164902†
Euro-SA-O1/Lombardy/ITL/46Lombardy, Italy1946Not knownM58601
Euro-SA-O2/Brescia/ITL/47Brescia, Italy1947Not knownM55287
ME-SAPanAsiaO/JPN/2000Miyazaki, JapanApr 7, 2000BovineAB079061
ME-SAIran2001O/JOR/2/95Amman Governorate, JordanOct 30, 1995BovineDQ164903†
EA-1-O/K77/78*Manera Est., Naivasha, Kenya1978Not knownDQ165072
EA-1-O/K83/79*Mweiga, Nyeri Dist., Central Prov., Kenya1979BovineAJ303511
EA-2O/KEN/5/2002Nakuru, Lanet Division, KenyaOct 9, 2002BovineDQ165073
ME-SAInd2001O/KUW/3/97Kuwait1997BovineDQ164904†
ME-SAPanAsiaO/KUW/1/98Warfra (Al Warfah), KuwaitMay 2, 1998BovineDQ164905†
SEA-O/LAO/4/98Attapeu, LaosSep 24, 1998BuffaloDQ164906†
ME-SAPanAsiaO/LAO/2/2000Kephathao, Sayabluly, LaosJan 26, 2000Not knownAJ318844†
SEA-O/LAO/4/2001Xieng Khouang, LaosAug 3, 2001BovineDQ164907†
ME-SAPanAsiaO/LAO/3/2003Xaythany, VT Municipality, LaosMar 21, 2003BovineDQ164908†
ME-SAPanAsiaO/LAO/11/2003Xaysettha, VT Municipality, LaosMay 12, 2003BuffaloDQ164909†
ME-SAPanAsiaO/LAO/12/2003Hatxaifong, VT Municipality, LaosMay 15, 2003BovineDQ164910†
ME-SAPanAsiaO/LAO/13/2003Xaysettha, VT Municipality, LaosMay 16, 2003BuffaloDQ164911†
ME-SAPanAsiaO/LAO/17/2003Tonepheung, Borkeo, LaosMay 25, 2003BuffaloDQ164912†
ME-SAPanAsiaO/LAO/19/2003Tonepheung, Borkeo, LaosMay 27, 2003BovineDQ164913†
ME-SAPanAsiaO/LAO/21/2003Chanthabuly, VT Municipality, LaosJun 25, 2003PorcineDQ164914†
ME-SAPanAsiaO/LAO/23/2003Chanthabuly, VT Municipality, LaosJun 26, 2003PorcineDQ164915†
ME-SAPanAsiaO/LAO/28/2003Thaphabath, Borikhamxai, LaosSep 16, 2003BovineDQ164916†
ME-SAPanAsiaO/LAO/30/2003Thaphabath, Borikhamxai, LaosOct 4, 2003PorcineDQ164917†
ME-SAPanAsiaO/LAO/31/2003Thaphabath, Borikhamxai, LaosOct 4, 2003PorcineDQ164918†
ME-SAPanAsiaO/LEB/1/2003LebanonMar 26, 2003BovineDQ164919†
EA-2-O/MAL/1/98Mwongulukulu dip tank, Karonga, Northern MalawiNov 6, 1998Not knownDQ165074
ME-SAPanAsiaO/MAY/2/2000Kilang Papan, Batu Arang, Selangor, MalaysiaJan 2, 2000BovineAJ318846†
SEA-O/MAY/3/2001S.G Kelambu Kuala Langat, Selangor, MalaysiaJun 23, 2001BovineDQ164920†
SEA-O/MAY/5/2001Twluk Jering, Kelantan, Tumpat, MalaysiaJul 11, 2001BovineDQ164921†
SEA-O/MAY/6/2001Twluk Jering, Kelantan, Tumpat, MalaysiaJul 11, 2001BovineDQ164922†
SEA-O/MAY/1/2002Pengkala Huln, Perak, MalaysiaJan 10, 2002BovineDQ164923†
ME-SAPanAsiaO/MAY/6/2003Rompin, Pahang, MalaysiaDec 28, 2003BovineDQ165058
SEA-O/MYA/13/89Kyaik Latt, MyanmarJul 20, 1989BovineDQ164924†
SEA-O/MYA/7/98U Uin Myint, Warr Ta Ya, Htan Ta Pin, Yangon, MyanmarJul 14, 1998BovineDQ164925†
SEA-O/MYA/5/99U Khin Win, Tha Pyay Sein, Zigon, Bago, MyanmarJun 8, 1999BovineDQ164926†
SEA-O/MYA/2/2000Kant Malar, Yangon, Kungyaw Kone, MyanmarMay 23, 2000BovineDQ164927†
SEA-O/MYA/7/2002Hlayhlaninn, Hlegu, Yangon, MyanmarOct 23, 2002PorcineDQ164928†
ME-SAPanAsiaO/NEP/111/90Kathmandu, NepalMay 17, 1990PorcineDQ164929†
ME-SAPanAsiaO/NEP/121/90Bhojpur, NepalSep 23, 1990BovineDQ164930†
ME-SAO/NEP/6/91Kathmandu, NepalJun 5, 1991BovineDQ164931†
ME-SAO/NEP/4/92Kathmandu, NepalOct 22, 1992BovineDQ164932†
ME-SAPanAsiaO/NEP/104/97k.b. Budhathoki, Kathmandu, NepalOct 16, 1997BovineDQ164933†
ME-SAPanAsiaO/NEP/109/97Okhaldhunga, NepalNov 30, 1997buffaloDQ164934†
ME-SAPanAsiaO/NEP/4/98Kathmandu, NepalApr 30, 1998PorcineDQ164935†
ME-SAPanAsiaO/NEP/9/98Lalitpur, NepalOct 4, 1998BovineDQ164936†
ME-SAPanAsiaO/NEP/2/99Pyuthan, NepalJan 4, 1999BovineDQ164937†
ME-SA-O/NEP/12/2000Kathmandu, NepalJun 14, 2000BovineDQ164938†
ME-SA-O/NEP/13/2000Kathmandu, NepalJun 14, 2000BovineDQ164939†
ME-SAPanAsiaO/NEP/4/2003Lalitpur, NepalMay 9, 2003BovineDQ165059
ME-SAPanAsiaO/NEP/5/2003Gagalphed 1-7, Kathmandu, NepalMay 29, 2003BovineDQ165060
ME-SAPanAsiaO/NEP/6/2003Gagalphed 1-7, Kathmandu, NepalJun 9, 2003BovineDQ165061
ME-SAInd2001O/OMN/4/2001Oman2001CaprineDQ164940†
ME-SAInd2001O/OMN/7/2001Oman2001BovineDQ164941†
ME-SAIran2001O/PAK/15/2002Sheikh Pura, Punjab, PakistanMar 15, 2002BuffaloDQ165062
ME-SAIran2001O/PAK/16/2002PakistanMar 15, 2002BovineDQ165063
ME-SAIran2001O/PAK/18/2002Karachi, PakistanJul 27, 2002BovineDQ165064
ME-SAIran2001O/PAK/1/2003Karachi, PakistanJan 6, 2003BovineDQ165065
ME-SAPak98O/PAK/12/2003Lahore, Punjab, Pakistan2003Not knownDQ165066
ME-SAPak98O/PAK/14/2003Lahore, Punjab, Pakistan2003Not knownDQ165067
ME-SAPak98O/PAK/16/2003Lahore, Punjab, Pakistan2003Not knownDQ165068
ME-SAPak98O/PAK/17/2003Lahore, Punjab, Pakistan2003Not knownDQ165069
ME-SAPanAsiaO/PAK/45/2003PakistanMay 19, 2003BovineDQ164942†
ME-SAIran2001O/PAK/53/2003PakistanMay 27, 2003BuffaloDQ164943†
ME-SAPak98O/PAK/73/2003PakistanOct 27, 2003Not knownDQ165070
ME-SAInd2001O/PAT/2/2002Deir Dibwan, Ramallah, Palestinian Autonomous Territories2002BovineDQ164944†
ME-SAInd2001O/PAT/3/2002Nr. Ramallah, Palestinian Autonomous TerritoriesNov 12, 2002BovineDQ164945†
Cathay-O/PHI/5/95Bauang, La Union, PhilippinesFeb 9, 1995PorcineDQ164946†
Cathay-O/PHI/7/96Mahabang Parang, Angono, Rizal, Philippines Nov 1, 1996PorcineAJ294926
Cathay-O/PHI/5/2000(Cabanatuan), 111, Nueva Ecija, PhilippinesFeb 8, 2000PorcineDQ164947†
Cathay-O/PHI/13/2000Staana, 111, Pamapanga, PhilippinesMar 2, 2000PorcineDQ164948†
Cathay-O/PHI/14/2000Vicotria, 1V, Oriental Mindoro, PhilippinesMar 11, 2000PorcineDQ164949†
Cathay-O/PHI/5/2003Bangued, CAR, Abra, PhilippinesFeb 10, 2003PorcineDQ164950†
Cathay-O/PHI/10/2003Muntinlupa City, NCR, Muntinlupa, PhilippinesMar 4, 2003PorcineDQ164951†
Cathay-O/PHI/17/2003Guagua, 111, Pampanga, PhilippinesApr 8, 2003PorcineDQ164952†
Cathay-O/PHI/21/2003Antipolo City, 1V, Rizal, PhilippinesMay 13, 2003PorcineDQ164953†
Cathay-O/PHI/23/2003Cainta, 1V, Rizal, PhilippinesMay 15, 2003PorcineDQ164954†
Cathay-O/PHI/1/2004Cabaroandaya, 1, Vigan Ilocos Sur, PhilippinesJan 13, 2004PorcineDQ164955†
Cathay-O/PHI/2/2004Guagua, II, Pampanga, PhilippinesJan 16, 2004PorcineDQ164956†
Cathay-O/PHI/3/2004Quezon City, NCR, Metro Manila, PhilippinesJan 5, 2004PorcineDQ164957†
Cathay-O/PHI/4/2004Tondo, NCR, Metro Manila, PhilippinesMar 24, 2004PorcineDQ164958†
Cathay-O/PHI/5/2004Pinagbuhatan, NCR, Pasig City, PhilippinesJun 1, 2004PorcineDQ164959†
Cathay-O/PHI/6/2004Caloocan City, NCR, Metro Manila, PhilippinesJun 21, 2004PorcineDQ164960†
Cathay-O/PHI/7/2004Gerona, III, Tarlac, PhilippinesJun 29, 2004PorcineDQ164961†
Cathay-O/PHI/8/2004Guiguinto, III, Bulacan, PhilippinesJul 14, 2004PorcineDQ164962†
Cathay-O/PHI/9/2004Mayamot, Antipolo, IV B, Rizal, PhilippinesJul 21, 2004PorcineDQ164963†
Cathay-O/PHI/10/2004NCR, Quezon City, PhilippinesAug 4, 2004PorcineDQ164964†
Cathay-O/PHI/11/2004Muntinlupa, NCR, Metro Manila, PhilippinesSep 3, 2004PorcineDQ164965†
Cathay-O/PHI/12/2004Binan, IV B, Laguna, PhilippinesSep 29, 2004PorcineDQ164966†
ME-SAPanAsiaO/QTR/3/99Al-Wabra, Wildlife Preservation, Dohar, QatarFeb 27, 1999Dorcas gazelleDQ164967†
ME-SAPanAsiaO/SAR/1/2000Camperdown, Kwazulu-Natal, South AfricaSep 2000PorcineAJ318860†
ME-SA-O/SAU/2/97Riyadh, Saudi ArabiaMay 1997BovineAJ318851†
ME-SAPanAsiaO/SAU/38/98Al‑Kharj, Saudi Arabia1998BovineAJ318852†
ME-SAPanAsiaO/SAU/2/99Saudi Arabia1999Not knownDQ164968†
ME-SAInd2001O/SAU/3/2001Asier, Saudi ArabiaMar 2001BovineDQ164969†
ME-SAInd2001O/SAU/11/2001Al Karj, Saudi ArabiaJan 2001BovineDQ164970†
ME-SAPanAsiaO/SAU/13/2001Almaria, Riyadh, Saudi ArabiaOct 12, 2001BovineDQ164971†
ME-SAPanAsiaO/SKR/1/2000Papyung, P’aju City, Kyunggi, Republic of KoreaMar 26, 000BovineAJ318854†
ME-SAPanAsiaO/SKR/2000ChungJu county, Kyunggi province, Republic of KoreaMay 2000BovineAJ539139
ME-SAPanAsiaO/SKR/2000Republic of Korea2000Not known AF377945
ME-SAPanAsiaO/SKR/2000Republic of Korea2000Not known AF428246
ME-SAPanAsiaO/SKR/1/2002Samjuk, Anseong, Kyonggi province, Republic of KoreaMay 2, 2002PorcineDQ164972†
ME-SAPanAsiaO/SKR/AS/2002Samjuk, Anseong, Kyonggi province, Republic of Korea2002PorcineAY114146
EA-3-O/SUD/2/86Omdurman, Khartoum, SudanNov 17, 1986BovineDQ165075
EA-3-O/SUD/1/99Sudan1999Not knownDQ165076
ME-SAPanAsiaO/SYR/1/2002SyriaFeb 2002Not knownDQ164973†
ME-SAPanAsiaO/SYR/2/2002SyriaFeb 2002Not knownDQ164974†
ME-SAPanAsiaO/SYR/3/2002SyriaFeb 2002Not knownDQ164975†
SEA-O/TAI/4/99Mae Hong Son, ThailandMar 1999BovineDQ164976†
SEA-O/TAI/8/99Buriram, ThailandJun 1999BovineDQ164977†
ME-SAPanAsiaO/TAI/9/99Chieng Rai, ThailandJun 1999BovineDQ164978†
SEA-O/TAI/2/2000Songkhla, ThailandJan 18, 2000BovineDQ164979†
ME-SAPanAsiaO/TAI/2/2003Nakhon Ratchasima, ThailandMar 10, 2003BovineDQ164980†
SEA-O/TAI/3/2003Nakompathom, ThailandMay 19, 2003PorcineDQ164981†
Cathay-O/TAW/81/97I-lan, Taiwan POC17/04/1997PorcineAJ296321
ME-SAPanAsiaO/TAW/2/99Kinmen, Taiwan POCJun 1999BovineAJ294927
Cathay-O/TAW/4/99Penghu Island, Taiwan POCFeb 1999PorcineAJ294928
ME-SABranch BO1/Manisa/TUR/69Manisa, TurkeyApr 1969BovineAJ251477
ME-SAIran2001O/TUR/2/2000Merlez, Balikesir, Turkey2000BovineDQ164982†
ME-SAPanAsiaO/TUR/5/2000Nigde, Turkey2000BovineDQ164983†
ME-SAPanAsiaO/TUR/8/2000Konya, Turkey2000BovineDQ164984†
ME-SAPanAsiaO/TUR/2/2001Kastamonu, Kastamonu, TurkeyJan 26, 2001BovineDQ164985†
ME-SAPanAsiaO/TUR/3/2002Diyarbakir, Diyarbakir, Turkey2002BovineDQ164986†
ME-SAIran2001O/TUR/5/2002Sivas, Sivas, Turkey2002BovineDQ164987†
ME-SAPanAsiaO/TUR/12/2002Dozansehir, Malatya, TurkeyMay 2002BovineDQ164988†
ME-SAPanAsiaO/TUR/1/2003Aksaray, Turkey2003BovineDQ164989†
ME-SAPanAsiaO/TUR/3/2003Amasya, Turkey2003BovineDQ164990†
ME-SAPanAsiaO/TUR/7/2003Nigde, Turkey2003BovineDQ164991†
ME-SAInd2001O/UAE/7/97Al Ain, United Arab EmiratesMay 1997BovineDQ164992†
ME-SAPanAsiaO/UAE/4/99United Arab Emirates1999AntelopeDQ164993†
ME-SAPanAsiaO/UAE/1/2000Al Rawabi, Dubai, United Arab EmiratesMay 6, 2000BovineDQ164994†
ME-SAPanAsiaO/UAE/2/2000Al Rawabi, Dubai, United Arab EmiratesMay 6, 2000BovineDQ164995†
ME-SAPanAsiaO/UAE/3/2000Al Rawabi, Dubai, United Arab EmiratesMay 6, 2000BovineDQ164996†
ME-SAInd2001O/UAE/6/2001Al Ain, United Arab EmiratesMar 2001BovineDQ164997†
EA-2-O/UGA/3/2002Nakasongola, Uganda2002Not knownDQ165077
ME-SAPanAsiaO/UKG/12/2001Brentwood, Essex, UK.Feb 19, 2001PorcineAJ311724
ME-SAPanAsiaO/UKG/31/2001Brentwood, Essex, UK.Feb 20, 2001BovineDQ164998†
ME-SAPanAsiaO/UKG/35/2001Brentwood, Essex, UK.Feb 20, 2001PorcineAJ539141
ME-SAPanAsiaO/UKG/123/2001Brentwood, Essex, UK.Feb 22, 2001BovineDQ164999†
ME-SAPanAsiaO/UKG/128/2001Heddon-on-the-Wall, Northumberland, UK.Feb 22, 2001PorcineDQ165000†
ME-SAPanAsiaO/UKG/130/2001Canewdon, Essex, UK.Feb 22, 2001PorcineDQ165001†
ME-SAPanAsiaO/UKG/150/2001Ponteland, Northumberland, UK.Feb 23, 2001BovineDQ165002†
ME-SAPanAsiaO/UKG/152/2001Ponteland, Northumberland, UK.Feb 23, 2001BovineDQ165003†
ME-SAPanAsiaO/UKG/174/2001Beaworthy, Highamton, Devon, UK.Feb 24, 2001BovineDQ165004†
ME-SAPanAsiaO/UKG/195/2001Bromham, Chippenham, Wiltshire, UK.Feb 2001BovineDQ165005†
ME-SAPanAsiaO/UKG/198/2001Burdon, Hatherleigh, Okehampton, Devon, UK.Feb 25, 2001BovineDQ165006†
ME-SAPanAsiaO/UKG/240/2001Llangarron, Ross-on-Wye, Herefordshire, UK.Feb 26, 2001BovineDQ165007†
ME-SAPanAsiaO/UKG/241/2001Llangarron, Ross-on-Wye, Herefordshire, UK.Feb 26, 2001BovineDQ165008†
ME-SAPanAsiaO/UKG/438/2001County Armagh, Northern Ireland, UK.Feb 28, 2001BovineDQ165009†
ME-SAPanAsiaO/UKG/478/2001Dryfesdale, Lockerbie, Dumfries & Galloway, UK.Feb 28, 2001BovineDQ165010†
ME-SAPanAsiaO/UKG/3730/2001Bogues, Ecclefechan, Lockerbie, Dumfries & Galloway, UK.Mar 30, 2001Not knownDQ165011†
ME-SAPanAsiaO/UKG/3802/2001Milton Damerel, Holsworthy, Devon, UK.Mar 30, 2001BovineDQ165012†
ME-SAPanAsiaO/UKG/4021/2001Cockermouth, Cumbria, UK.Apr 1, 2001BovineDQ165013†
ME-SAPanAsiaO/UKG/4027/2001Hawes, North Yorkshire, UK.Mar 29, 2001BovineDQ165014†
ME-SAPanAsiaO/UKG/4553/2001Jedburgh, Borders, UK.Apr 6, 2001BovineDQ165015†
ME-SAPanAsiaO/UKG/5060/2001Coagh, County Tyrone, Northern Ireland, UK.Apr 11, 2001BovineDQ165016†
ME-SAPanAsiaO/UKG/5565/2001Cushendall, County Antrim, Northern Ireland, UK.Apr 14, 2001BovineDQ165017†
ME-SAPanAsiaO/UKG/9359/2001Crathorne, Yarm, North Yorkshire, UK.May 16, 2001BovineDQ165018†
ME-SAPanAsiaO/UKG/13726/2001Abram, Wigan, Lancashire, UKJul 16, 2001BovineDQ165019†
Euro-SA-O3/VEN/51Venezuela1951Not knownAJ004645
SEA-O/VIT/2/97Vietnam1997BovineAJ294929
Cathay-O/VIT/3/97Vietnam1997PorcineAJ294930
SEA-O/VIT/7/97Uar, Krong Pa, Gialai, Region no. 37, VietnamAug 31, 1997Not knownAJ296328
ME-SAPanAsiaO/VIT/6/2002Vietnam2002Not knownDQ165020†
ME-SAPanAsiaO/VIT/8/2002Vietnam2002Not knownDQ165021†
ME-SAPanAsiaO/VIT/9/2002Vietnam2002Not knownDQ165022†
ME-SAPanAsiaO/VIT/10/2002Vietnam2002Not knownDQ165023†
ME-SAPanAsiaO/VIT/12/2002Vietnam2002Not knownDQ165024†
Cathay-O/VIT/13/2002Vietnam2002Not knownDQ165025†
ME-SAPanAsiaO/VIT/14/2002Kien Giang, VietnamFeb 2002PorcineDQ165026†
ME-SAPanAsiaO/VIT/16/2002Kien Giang, VietnamMar 2002PorcineDQ165027†
ME-SAPanAsiaO/VIT/19/2002Kontum, VietnamJun 2002BovineDQ165028†
ME-SAPanAsiaO/VIT/20/2002Binh Thuan, VietnamDec 2002BovineDQ165029†
ME-SAPanAsiaO/VIT/1/2003Phu Yen, Vietnam2003PorcineDQ165030†
ME-SAPanAsiaO/VIT/2/2003An Giang, VietnamAug 2003PorcineDQ165031†
ME-SAPanAsiaO/VIT/1/2004Kon Tum, VietnamFeb 2004BovineDQ165032†
Cathay-O/VIT/2/2004Quang Nam, VietnamFeb 2004PorcineDQ165033†
Cathay
-
O/VIT/3/2004
Quang Nam, Vietnam
Mar 2004
Porcine
DQ165034†
*Not a reference number of the World Reference Laboratory for Foot-and-Mouth Disease.
†Sequence determined in this study.
Three alternative primer combinations were used for reverse transcription–polymerase chain reaction (RT-PCR): O-1C244F/NK61, O-1C272F/NK61, and O-1C283F/NK61, which have amplicon sizes of 1,181, 1,153, and 1,142 bp, respectively (Table). Forward and reverse primer amounts were 20 and 40 pmol, respectively. We used 4–6 internal sequencing primers to ensure coverage of the VP1 region on both DNA strands (Table).
Table

Oligonucleotide primers used for RT-PCR and cycle sequencing of FMDV strains*

PrimerPrimer sequence (5´ → 3´)SenseLocation on FMDV genome
Use
GenePosition†
ARS4ACCAACCTCCTTGATGTGGCT+1C2349–2369RT-PCR
O-1C244FGCAGCAAAACACATGTCAAACACCTT+1C2469–2494RT-PCR
O-1C272FTBGCRGGNCTYGCCCAGTACTAC+1C2497–2519RT-PCR
O-1C283FGCCCAGTACTACACACAGTACAG+1C2508–2530RT-PCR
NK61GACATGTCCTCCTGCATCTG2B3630–3649RT-PCR
NK72GAAGGGCCCAGGGTTGGACTC2A/2B3558–3578Sequencing
O-1C499FTACGCGTACACCGCGTC+1C2724–2740Sequencing
O-1C583FGACGGYGAYGCICTGGTCGT+1C2808–2827Sequencing
A-1C612FTAGCGCCGGCAAAGACTTTGA+1C2834–2854Sequencing
O-1D296FACAACACCACCAACCCAAC+1D3181–3199Sequencing
O-1D628RGTTGGGTTGGTGGTGTTGT1D3181–3199Sequencing

*RT-PCR, reverse transcription–polymerase chain reaction; FMDV, food-and-mouth disease virus.

†Position on the genome of O1/Kaufbeuren/FRG/66 (EMBL/GenBank accession no. X00871).

*RT-PCR, reverse transcription–polymerase chain reaction; FMDV, food-and-mouth disease virus. †Position on the genome of O1/Kaufbeuren/FRG/66 (EMBL/GenBank accession no. X00871).

RT-PCR of vRNA

Total RNA was extracted from 460 μL of a 10% epithelial suspension or cell culture supernatant by using RNeasy kits (Qiagen Ltd., Crawley, West Sussex, UK), according to the manufacturer's instructions, and resuspended in 50 μL nuclease-free water. This RNA (5 μL) was used as the template in a 1-step RT-PCR (Ready-To-Go RT-PCR Beads; Amersham Pharmacia Biosciences, Chalfont St. Giles, Bucks, UK). The following thermal profile was used: 42°C for 30 min; 94°C for 5 min; 35 cycles of 94°C for 60 s; 60°C for 60 s; and 72°C for 90 s; followed by a final extension of 72°C for 5 min. PCR products were analyzed by electrophoresis on a 1.5% agarose-Tris-borate-EDTA gel containing 0.5 μg/mL ethidium bromide. DNA weight markers (GeneRuler 100 bp DNA Ladder Plus, Ready-To-Use; Fermentas, Inc., Hanover, MD, USA) were run alongside the samples to facilitate product identification and quantification. Post-PCR removal of deoxynucleoside triphosphates and primers was achieved enzymatically by using ExoSAP-IT (USB Corporation, Cleveland, OH, USA), according to the manufacturer's instructions.

Sequence Determination

PCR amplicons were sequenced by using the DTS Quick Start Kit (Beckman Coulter Inc., Fullerton, CA, USA) according to the manufacturer's instructions and with the sequencing primers listed in the Table. The sequencing reactions were run on a CEQ8000Automated Sequencer (Beckman Coulter) according to the manufacturer's instructions. The sequences determined in this study have been submitted to the EMBL/GenBank/DDBJ databases; accession numbers are shown in Table A1.

Phylogenetic Analysis

An unrooted neighbor-joining tree was constructed by using MEGA version 3 (). The robustness of the tree topology was assessed with 1,000 bootstrap replicates as implemented in the program.

Results and Discussion

Virus RNA was extracted from 188 FMD type O viruses, and each VP1-coding region was successfully amplified by RT-PCR by using at least 1 of the 3 described primer sets. The complete VP1 sequences were determined by directly sequencing the amplicons. For all these isolates, the VP1 gene consisted of 633 nt coding for 211 amino acids (previously VP1 was considered to be 2 amino acids longer at its carboxyl-terminus; however, the VP1-2A cleavage site is actually between a conserved glutamine [VP1211 in most type Os] and a variable residue [2A1, often a leucine in serotype O]) (). The 188 VP1 sequences we report were compared to 151 VP1 sequences previously published or awaiting publication (database accession numbers are listed in Table A1). A bootstrapped neighbor-joining tree containing all 339 sequences was constructed by using MEGA 3 (Figure 1). Figures 2–4 show various parts of the tree depicted in Figure 1 in greater detail. The bootstrap support for the 10 FMDV O topotypes was generally high (96%–100%; Figure 2). The topotype distributions of the 299Asian FMD type O viruses (including those reported elsewhere) were as follows: ME-SA (253), SEA (18), and Cathay (49) (Table A1). Additionally, 26 European viruses (from the United Kingdom, Ireland, and France) belonged to the ME-SA topotype. The PanAsia strain accounted for 168 (66%) of the 253 ME-SA isolates.
Figure 1

Midpoint–rooted neighbor-joining tree showing the relationships between the 339 VP1 sequences studied. Only the tree structure is shown; details of the boxes labeled A to C are shown in Figures 2–4.

Figure 2

Midpoint-rooted neighbor-joining tree showing the Cathay, Europe-South America (Euro-SA), Indonesia-1 (ISA-1), Indonesia-2 (ISA-2), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), and East Africa 3 (EA-3) topotypes. Only bootstrap values >70% are shown.

Figure 4

Midpoint-rooted neighbor-joining tree showing the PanAsia strain. Only bootstrap values >70% are shown.

Midpoint–rooted neighbor-joining tree showing the relationships between the 339 VP1 sequences studied. Only the tree structure is shown; details of the boxes labeled A to C are shown in Figures 2–4. Midpoint-rooted neighbor-joining tree showing the Cathay, Europe-South America (Euro-SA), Indonesia-1 (ISA-1), Indonesia-2 (ISA-2), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), and East Africa 3 (EA-3) topotypes. Only bootstrap values >70% are shown. Midpoint-rooted neighbor-joining tree showing the PanAsia strain. Only bootstrap values >70% are shown. Some FMDV O topotypes had a more limited spread than the ME-SA topotype. Virus isolates from Hong Kong and the Philippines all fell within the Cathay topotype; all the recently isolated (2000–2004) Philippines isolates form a distinct lineage. This topotype was first introduced into the Philippines in 1994, probably from mainland China or Hong Kong (the only known places where it existed at that time). Earlier isolates from the Philippines (e.g., O/PHI/5/95) were closely related to Hong Kong viruses (Figure 2). This topotype was first seen in Vietnam in 1997 and continued to occur there until 2004 (Figure 2) but has not, as far as we know, spread to neighboring Southeast Asian countries. A Cathay topotype virus also spread to Taiwan in 1997, where it caused an extensive epidemic that lasted until at least 1999 () (Figure 2). Viruses belonging to the SEA topotype continue to be isolated throughout Southeast Asia (Figure 2; Table A2), despite the recent introduction and widespread dissemination of the PanAsia strain. No examples of either of the Indonesian topotypes have been detected in the field since 1983.
Table A2

Occurrence of the PanAsia lineage of foot-and-mouth disease virus serotype O, 1990–2004*† Download PDF (45 KB, 3 pages)

Country
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
India
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
+
+
+
Nepal

ME-SA
ME-SA
ME-SA
ME-SA
ME-SA
ME-SA



ME-SA


ME-SA
+
Bhutan
+
+

ME-SA
+
+



+
+

ME-SA


Iran+++ME-SAME-SAME-SA+ME-SA

+
ME-SAME-SA
Jordan+ME-SAME-SAME-SAME-SA


Syria+ME-SA+-ME-SA


Saudi ArabiaME-SAME-SAME-SAME-SAME-SAME-SA?ME-SA

-
Yemen++++ME-SA
+

EA-3
EA-3
Lebanon++ME-SAME-SAME-SA??ME-SA



Kuwait++-ME-SAME-SAME-SAME-SA

+
Bahrain+ME-SAME-SAME-SA+ME-SAME-SAME-SA
++-
Qatar--
+
Iraq+

UAE+ME-SA+-ME-SA
ME-SA

ME-SA
-
TurkeyME-SAME-SAME-SAME-SAME-SAME-SAME-SA+ME-SA
ME-SA
ME-SA

+
Israel+ME-SAME-SA+ME-SAME-SAME-SA??
-
P.R. China++
Taiwan POC-------CHYCHYCHYCHY
Sri Lanka+ME-SA+++ME-SA+ME-SA++
Myanmar+++++SEASEASEA
SEA+SEA
Thailand+SEASEA+SEASEA++SEA
SEA
+SEASEA
+
Vietnam---+SEA+SEA/CHY

CHYCHY
CHY
Laos++SEA-SEA

SEA
Malaysia--SEA+SEAME-SASEA+-SEA
SEASEASEA
Cambodia+-SEA+SEA+++SEASEA
Japan----------
----
South Korea----------
--
Russia-----CHY----
---+
Mongolia----------
-+
South Africa----------
---
UK-----------
---
Eire-----------
---
France-----------
---
Netherlands--------------
Afghanistan++ME-SA+
+
Pakistan+++ME-SA+ME-SAME-SAME-SAME-SA-
Bulgaria-ME-SA-ME-SA--ME-SA------
Greece----ME-SA-ME-SA--------
Bangladesh++++++ME-SA+++-
ArmeniaME-SA+--
Azerbaijan++--
Georgia+ME-SA+-
Hong KongCHYCHYCHYCHYCHYCHYCHYCHYCHYCHYCHYCHYCHYCHYCHY
Indonesia---------------
Kazakhstan-+++
KyrgyzstanME-SA-+-
North Korea---------------
Oman+ME-SA++++ME-SA--
Philippines----CHYCHYCHYCHYCHYCHYCHYCHYCHYCHYCHY
TajikistanME-SA----+-
Turkmenistan--+++
UzbekistanME-SA---------

*Compiled from the Food and Agriculture Organization/World Health Organization/Organization for Animal Health Yearbooks and the records of the World Reference Laboratory for FMD. 
†Abbreviations: solid boxes, PanAsia virus isolated; blank boxes, unknown disease situation; +, FMD type O present (genotype not known); -, no FMD type O reported; 
CHY, Cathay topotype; ME-SA, Middle East-South Asia topotype (other than PanAsia strain); SEA, Southeast Asia topotype.

Viruses belonging to the ME-SA topotype occur in many genetic sublineages (Figure 3). These were often initially found in India and subsequently spread to other geographic regions. The reference/vaccine strains (O5/IND/1/62, O1/Manisa/TUR/69, O1/Sharquia/EGY/72, and O/IND/R2/75) all occur in a single lineage distinct from later isolates. The O5/IND/1/62 sequenced by Hemadri et al. () is different (9.6%) from the same strain that we and others sequenced (,) (all 3 sequences are identical, and the virus stocks probably all originated from WRLFMD), and the origin of these isolates requires further investigation. Two other reference/vaccine strains (O/Geshur/ISR/85 and O/Dalton/ISR/2/88) fall on another lineage but are not closely related to each other. Within the ME-SA topotype, several sublineages have been defined as strains, such as PanAsia, Ind2001, and Iran2001, on the basis of phylogenetic relationships and a nucleotide difference of <5% (,). However, these are artificial groupings, the edges of which become blurred as viruses evolve in different directions. For example, the nucleotide sequences of 2 viruses that are on the PanAsia lineage, O/VIT/1/2004 and O/BHU/27/2004, differ from O/TAW/2/99 by 5.4% and 5.0%, respectively, but differ from each other by 7.9%. Thus trying to define "strains," particularly using percentage nucleotide relationships, may not be relevant, except in special circumstances, such as a pandemic caused by a cluster of closely related viruses.
Figure 3

Midpoint-rooted neighbor-joining tree showing the Middle East–South Asia (ME-SA) topotype (except the PanAsia strain). Only bootstrap values >70% are shown.

Midpoint-rooted neighbor-joining tree showing the Middle East–South Asia (ME-SA) topotype (except the PanAsia strain). Only bootstrap values >70% are shown. Viruses that we consider part of the PanAsia strain (within the ME-SA topotype) are shown in Figure 4. Within the PanAsia strain, different sublineages can be distinguished despite some low bootstrap values. Some of them correspond to well-defined geographic areas in which these isolates have been collected through the years and show evolutionary relationships. Others are mixtures of FMDV isolates from different regions. In such cases, the phylogeny gives clues to the probable source of some isolates. The PanAsia strain shows a limited degree of variability of the VP1 gene during the outbreak in 2001 in the United Kingdom. Indeed, the degree of genetic variability of the VP1 gene of 24 isolates collected between the beginning and the end of the outbreak was <1.29%, and very few amino acid changes were observed (a maximum of 3 in any 1 sequence). According to our current analysis, the PanAsia strain is an emergent sublineage of FMDV that, after several years in India, spread through southern Asia, the Middle East, and Europe. This strain apparently was confined to India for longer—and then spread much faster—than previously believed. In 1994, Samuel et al. () first noted the arrival of a new FMDV type O lineage in Saudi Arabia. Previously, we had considered this lineage to be part of the PanAsia strain (). However, analysis of complete VP1 sequences with the neighbor-joining algorithm, rather than unweighted pair-group method analysis on partial VP1 sequences, indicated that these viruses, along with others isolated between 1994 and 1997 in Asia (except India), actually belong to 1 of 2 distinct lineages that we have termed Ind2001 and Iran2001 (Figure 3). Therefore, viruses that we would now classify as PanAsia first appeared in Bahrain, Iran, Lebanon, Kuwait, Saudi Arabia, and Yemen much later (i.e., in 1998); in Israel, Turkey, and the United Arab Emirates in 1999; and in Malaysia in 2000 (Figures 3 and 4; data not shown). In Nepal in 1990, viruses were found that were closely related to the earliest PanAsia isolates from India in the same year. However, from 1991 to 1996, only viruses belonging to non-PanAsia lineages of ME-SA were found in Nepal. During the years 1997–1999, PanAsia viruses were once again found. This virus lineage may have persisted in Nepal in the intervening years (since only a few virus isolates have been examined) or may have been reintroduced in 1997. This extension and reanalysis of the sequence data indicate that the spread of the PanAsia strain from the Indian subcontinent was probably more explosive than once thought and principally occurred from 1998 to 2001. Retrospective examination of viruses from India indicated that the PanAsia strain was present in the north of that country as early as 1990 and may even have been present as far back as 1982 (). From 1991 to 1997, the new lineage appeared to spread to other parts of India (). The presumed initial spread from India in 1998 was to Bhutan, Bahrain, Iran, Jordan, Kuwait, Lebanon, Syria, Saudi Arabia, and the Yemen Arab Republic. In May 1999, the People's Republic of China reported FMD outbreaks in Tibet, Hainan, and Fujian Provinces (). Sequencing viruses from the outbreaks in Tibet (O/CHA/1/99, O/CHA/2/99, and O/CHA/3/99) and Hainan (O/CHA/4/99) showed that they belonged to the new lineage () (Figure 4). In June 1999, FMDV was isolated from subclinically infected or carrier cattle in Kinmen Prefecture of Taiwan Province of China (POC) during routine surveillance. Sequence analysis of this isolate (O/TAW/2/99) showed it also belonged to the new lineage (Figure 4). Later that month, FMDV was detected in Tainan Prefecture on the main island of Taiwan, again in cattle showing no signs of disease. In January 2000, the first clinical cases in cattle were found in Taiwan (Yunlin and Chiayii Prefectures) and in February 2000, ≈71 young goats in Kaoshiung and Changhwa Prefectures died suddenly from FMD, although no disease was seen in adult goats that had been vaccinated. The distribution of this sublineage throughout Asia justified its name of the PanAsia strain. Towards the end of 1999, the PanAsia virus was clearly moving into Southeast Asia (Myanmar, Thailand, Vietnam, Lao People's Democratic Republic) (Table A2), where the FMDV type O SEA topotype had existed exclusively (at least until the Cathay topotype was introduced into Vietnam in 1997) (). By April 2000, all mainland Southeast Asian countries had experienced outbreaks due to the new strain. In March 2000, FMD type O appeared in South Korea and Japan, and sequence analysis indicated that the PanAsia strain was responsible () (Figure 4). In April 2000, a severe outbreak of FMD type O in occurred in pigs in the Ussuriysk District of eastern Russia. Of 625 pigs affected, nearly 37% died from the disease. Sequencing the VP1 gene showed that the PanAsia strain was responsible (). At the end of April 2000, an outbreak of FMD type O was reported in Ulaanbadrakh Soum County, Dornogovi Province, Mongolia. In this outbreak sheep, goats, and cattle were affected. Again, sequence analysis of the VP1 gene showed the virus to be of the PanAsia lineage (). In September 2000, the PanAsia strain spread to KwaZulu-Natal Province in South Africa (,) (Figure 4); the origin was traced to feeding pigs with uncooked swill from a ship in the port of Durban (). This FMD outbreak is the first since 1957 in this region of South Africa and the first recorded outbreak in that country due to serotype O. In February 2001, FMD was diagnosed in the United Kingdom; by the end of July, >1,900 farms were affected. The PanAsia strain was responsible for these outbreaks (,,). In late February 2001, the disease spread from the British mainland to Northern Ireland, and in March and April outbreaks of FMD type O were also reported in the Republic of Ireland (n = 1), France (n = 2), and the Netherlands (n = 26). In 2003, the PanAsia strain was detected for the first time in Afghanistan, Nepal, and Pakistan; however, because of lack of samples or sequencing data, the strain may have been present earlier. Since 2003, the PanAsia strain has not been detected in any new countries. The PanAsia strain has not yet been detected in Africa (except South Africa in 2000) or South America, despite extensive unpublished sequence studies by ourselves; the Onderstepoort Veterinary Institute, South Africa (W. Vosloo, pers. comm.); and the Pan-American FMD Center, Brazil (I.E. Bergmann, pers. comm.). However, the PanAsia strain is present in many countries in which FMD is endemic and occurs in countries in which the incidence of FMD is sporadic. The extent of this spread is unique for a single strain of FMDV, and its presence in most recent samples from the Middle East indicates that it has dominated and outcompeted the other strains of FMDV previously observed (). While we acknowledge that the sampling of virus isolates is not random (i.e., the samples examined are those submitted to WRLFMD by some of the countries experiencing outbreaks), the same sampling technique has shown a marked increase in the number of isolations of the PanAsia lineage over the preceding years. The appearance of the PanAsia virus in countries that have been FMD-free for many years shows that this strain is capable of spreading to countries where strict control measures are normally effective at preventing importation of animal pathogens. Whether this fitness to survive is related to particular features of the transmissibility of the virus strain or its ability to spread subclinically in certain breeds of animal, as found in Taiwan in 1999 or in Japan in 2000 (), is not clear. The PanAsia virus strain has been isolated from a wide variety of host species, including cattle, water buffalo, pigs, sheep, goats, and gazelle (Qatar in 1999), and its ability to infect a wide range of species could be a contributing factor in its success. Within the PanAsia strain, differences in behavior of the virus, such as host species or virulence, remain unexplained on a genetic basis, according to comparison of the full genome sequences from viruses from this group (). However, these characteristics can also be biased by practices such as vaccination, the animal population targeted for vaccination, or the animal species that are farmed in a particular area. We have no evidence of increased or altered trade in the region that could explain the sudden spread of the PanAsia virus. Additionally, the lack of efficacy of existing FMDV vaccines does not seem to be responsible for the spread of this strain in countries in which vaccination is practiced. Indeed, antigenic matching analysis has shown good cross-reactivity between field isolates of the PanAsia strain and current vaccine strains such as O1 Manisa (WRLFMD, data not shown), and this finding has been confirmed for O/UKG/2001 virus by cross-protection studies (,). The spread of the PanAsia strain across most of Asia and into Europe and South Africa demonstrates how a newly evolved virus may become established, in spite of control measures at international borders. FMD in a previously disease-free country can seriously interfere with the local and export trade in susceptible animals and their products. A large outbreak of FMD in northern Europe or the United States could result in losses of several billion US dollars. The emergence of this strain of FMDV, and its spread within the territory bounded by Ireland in the west and Japan in the east, provides an example of the economic damage that can result. It also demonstrates the difficulty of containing such a transmissible virus within a defined region. The emergence of such strains highlights the necessity to constantly monitor and characterize field isolates responsible for outbreaks in FMD-endemic countries and the need for countries to be rapidly alerted so that appropriate control measures can be instituted. For this purpose, an international early warning system must be established to share information on the characteristics of the latest FMDV isolates in real time.
  19 in total

1.  Outbreak of foot-and-mouth disease virus serotype O in the UK caused by a pandemic strain.

Authors:  N J Knowles; A R Samuel; P R Davies; R P Kitching; A I Donaldson
Journal:  Vet Rec       Date:  2001-03-03       Impact factor: 2.695

2.  Molecular epidemiology of serotype O foot-and-mouth disease virus with emphasis on West and South Africa.

Authors:  O Sangare; A D Bastos; O Marquardt; E H Venter; W Vosloo; G R Thomson
Journal:  Virus Genes       Date:  2001-06       Impact factor: 2.332

Review 3.  Foot-and-mouth disease virus: cause of the recent crisis for the UK livestock industry.

Authors:  A R Samuel; N J Knowles
Journal:  Trends Genet       Date:  2001-08       Impact factor: 11.639

4.  Experimental studies with foot-and-mouth disease virus, strain O, responsible for the 2001 epidemic in the United Kingdom.

Authors:  N Aggarwal; Z Zhang; S Cox; R Statham; S Alexandersen; R P Kitching; P V Barnett
Journal:  Vaccine       Date:  2002-06-07       Impact factor: 3.641

Review 5.  Control of foot and mouth disease: lessons from the experience of the outbreak in Great Britain in 2001.

Authors:  J M Scudamore; D M Harris
Journal:  Rev Sci Tech       Date:  2002-12       Impact factor: 1.181

Review 6.  Economic costs of the foot and mouth disease outbreak in the United Kingdom in 2001.

Authors:  D Thompson; P Muriel; D Russell; P Osborne; A Bromley; M Rowland; S Creigh-Tyte; C Brown
Journal:  Rev Sci Tech       Date:  2002-12       Impact factor: 1.181

7.  Epidemiological characteristics and financial costs of the 1997 foot-and-mouth disease epidemic in Taiwan.

Authors:  P C Yang; R M Chu; W B Chung; H T Sung
Journal:  Vet Rec       Date:  1999 Dec 18-25       Impact factor: 2.695

8.  Foot-and-mouth disease type O viruses exhibit genetically and geographically distinct evolutionary lineages (topotypes).

Authors:  A R Samuel; N J Knowles
Journal:  J Gen Virol       Date:  2001-03       Impact factor: 3.891

9.  Emergence of a new strain of type O foot-and-mouth disease virus: its phylogenetic and evolutionary relationship with the PanAsia pandemic strain.

Authors:  Divakar Hemadri; Chakradhar Tosh; Aniket Sanyal; Ramamurthy Venkataramanan
Journal:  Virus Genes       Date:  2002       Impact factor: 2.332

Review 10.  Molecular epidemiology of foot-and-mouth disease virus.

Authors:  N J Knowles; A R Samuel
Journal:  Virus Res       Date:  2003-01       Impact factor: 3.303

View more
  50 in total

1.  Genetic characterization of a new pandemic Southeast Asia topotype strain of serotype O foot-and-mouth disease virus isolated in China during 2010.

Authors:  Haixue Zheng; Jijun He; Jianhong Guo; Ye Jin; Fan Yang; Lv Lv; Xiangtao Liu
Journal:  Virus Genes       Date:  2011-09-20       Impact factor: 2.332

2.  Co-expression of the Bcl-xL antiapoptotic protein enhances the induction of Th1-like immune responses in mice immunized with DNA vaccines encoding FMDV B and T cell epitopes.

Authors:  Sultan Gülçe İz; Mert Döşkaya; Belen Borrego; Fernando Rodriguez; Yüksel Gürüz; Ismet Deliloğlu Gürhan
Journal:  Vet Res Commun       Date:  2013-03-13       Impact factor: 2.459

3.  Spatial trend of Foot and Mouth Disease virus (FMDV) serotypes in cattle and buffaloes, Pakistan.

Authors:  Muhammad Abubakar; Muhammad Javed Arshed; Qurban Ali; Manzoor Hussain
Journal:  Virol Sin       Date:  2012-10-11       Impact factor: 4.327

4.  Evaluation of infectivity and transmission of different Asian foot-and-mouth disease viruses in swine.

Authors:  Juan M Pacheco; P W Mason
Journal:  J Vet Sci       Date:  2010-06       Impact factor: 1.672

Review 5.  Parameterization of the duration of infection stages of serotype O foot-and-mouth disease virus: an analytical review and meta-analysis with application to simulation models.

Authors:  Fernando Mardones; Andrés Perez; Javier Sanchez; Mohammad Alkhamis; Tim Carpenter
Journal:  Vet Res       Date:  2010-03-08       Impact factor: 3.683

6.  Recombinant DNA and Protein Vaccines for Foot-and-mouth Disease Induce Humoral and Cellular Immune Responses in Mice.

Authors:  Ji-Young Bae; Sun-Hwa Moon; Jung-Ah Choi; Jong-Sug Park; Bum-Soo Hahn; Ki-Yong Kim; Byunghan Kim; Jae-Young Song; Dae-Hyuck Kwon; Suk-Chan Lee; Jong-Bum Kim; Joo-Sung Yang
Journal:  Immune Netw       Date:  2009-12-31       Impact factor: 6.303

7.  Genetic characterization and molecular epidemiology of foot-and-mouth disease viruses isolated from Afghanistan in 2003-2005.

Authors:  Kate R Schumann; Nick J Knowles; Paul R Davies; Rebecca J Midgley; Jean-Francois Valarcher; Abdul Quader Raoufi; Thomas S McKenna; William Hurtle; James P Burans; Barbara M Martin; Luis L Rodriguez; Tammy R Beckham
Journal:  Virus Genes       Date:  2008-02-16       Impact factor: 2.332

8.  Multiple origins of foot-and-mouth disease virus serotype Asia 1 outbreaks, 2003-2007.

Authors:  Jean Francois Valarcher; Nick J Knowles; Valery Zakharov; Alexey Scherbakov; Zhidong Zhang; You Jun Shang; Zai Xin Liu; Xiang Tao Liu; Aniket Sanyal; Divakar Hemadri; Chakradhar Tosh; Thaha J Rasool; Bramhadev Pattnaik; Kate R Schumann; Tammy R Beckham; Wilai Linchongsubongkoch; Nigel P Ferris; Peter L Roeder; David J Paton
Journal:  Emerg Infect Dis       Date:  2009-07       Impact factor: 6.883

9.  Genetic characterization of foot-and-mouth disease viruses, Ethiopia, 1981-2007.

Authors:  Gelagay Ayelet; Mana Mahapatra; Esayas Gelaye; Berhe G Egziabher; Tesfaye Rufeal; Mesfin Sahle; Nigel P Ferris; Jemma Wadsworth; Geoffrey H Hutchings; Nick J Knowles
Journal:  Emerg Infect Dis       Date:  2009-09       Impact factor: 6.883

10.  Foot-and-mouth disease virus serotype A in Egypt.

Authors:  Nick J Knowles; Jemma Wadsworth; Scott M Reid; Katherine G Swabey; Alaa A El-Kholy; Adel Omar Abd El-Rahman; Hatem M Soliman; Katja Ebert; Nigel P Ferris; Geoffrey H Hutchings; Robert J Statham; Donald P King; David J Paton
Journal:  Emerg Infect Dis       Date:  2007-10       Impact factor: 6.883

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.