Literature DB >> 16430786

BACH1 Ser919Pro variant and breast cancer risk.

Pia Vahteristo1, Kristiina Yliannala, Anitta Tamminen, Hannaleena Eerola, Carl Blomqvist, Heli Nevanlinna.   

Abstract

BACKGROUND: BACH1 (BRCA1-associated C-terminal helicase 1; also known as BRCA1-interacting protein 1, BRIP1) is a helicase protein that interacts in vivo with BRCA1, the protein product of one of the major genes for hereditary predisposition to breast cancer. Previously, two BACH1 germ line missense mutations have been identified in early-onset breast cancer patients with and without family history of breast and ovarian cancer. In this study, we aimed to evaluate whether there are BACH1 genetic variants that contribute to breast cancer risk in Finland.
METHODS: The BACH1 gene was screened for germ line alterations among probands from 43 Finnish BRCA1/2 negative breast cancer families. Recently, one of the observed common variants, Ser-allele of the Ser919Pro polymorphism, was suggested to associate with an increased breast cancer risk, and was here evaluated in an independent, large series of 888 unselected breast cancer patients and in 736 healthy controls.
RESULTS: Six BACH1 germ line alterations were observed in the mutation analysis, but none of these were found to associate with the cancer phenotype. The Val193Ile variant that was seen in only one family was further screened in an independent series of 346 familial breast cancer cases and 183 healthy controls, but no additional carriers were observed. Individuals with the BACH1 Ser919-allele were not found to have an increased breast cancer risk when the Pro/Ser heterozygotes (OR 0.90; 95% CI 0.70-1.16; p = 0.427) or Ser/Ser homozygotes (OR 1.02; 95% CI 0.76-1.35; p = 0.91) were compared to Pro/Pro homozygotes, and there was no association of the variant with any breast tumor characteristics, age at cancer diagnosis, family history of cancer, or survival.
CONCLUSION: Our results suggest that the BACH1 Ser919 is not a breast cancer predisposition allele in the Finnish study population. Together with previous studies, our results also indicate that although some rare germ line variants in BACH1 may contribute to breast cancer development, the contribution of BACH1 germline alterations to familial breast cancer seems marginal.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16430786      PMCID: PMC1368988          DOI: 10.1186/1471-2407-6-19

Source DB:  PubMed          Journal:  BMC Cancer        ISSN: 1471-2407            Impact factor:   4.430


Background

BACH1 (BRCA1-associated C-terminal helicase 1, also known as BRCA1-interacting protein 1, BRIP1; GenBank: NM_032043) belongs to a DEAH helicase family and interacts in vivo with BRCA1, the protein product of one of the two major genes for hereditary breast cancer susceptibility [1,2]. Interaction is mediated through BRCT domains of BRCA1, motifs that have been shown to be important for the ability of BRCA1 to mediate double-strand break repair and homologous recombination as well as transcription activation [3,4]. The BACH1 gene is located at chromosome region 17q23. Besides genes known to be involved in the development and progression of breast cancer, such as BRCA1 at 17q21 and ERBB2 at 17q12, the presence of other breast cancer associated genes, both tumor suppressors and oncogenes, have been proposed in the long arm of chromosome 17 on the basis of loss of heterozygosity, allelic imbalance, and comparative genomic hybridization studies [5-9]. The possibility of a tumor suppressor gene located distal to BRCA1 and involved in both sporadic and hereditary ovarian cancer has also been discussed [10-12]. Previously, Cantor and co-workers have reported on BACH1 germ line missense mutations in early-onset breast cancer patients, with one of the patients having a strong family history of both breast and ovarian cancer [2]. In subsequent functional analysis both of the observed mutations, Pro47Ala that is located in a highly conserved nucleotide binding domain and Met299Ile that resides in a helicase homology region, were shown to perturb BACH1 protein function by altering both ATPase and helicase activity [13]. In addition to these rare mutations in individual families, a common Ser-allele of the Ser919Pro polymorphism has recently been associated with an increased breast cancer risk; in a kin-cohort study a 4.5-fold and up to 6.9-fold increased cumulative breast cancer risk was seen for the first degree relatives of Pro/Ser and Ser/Ser carriers vs. Pro/Pro carriers, respectively, by the age of 50 years [14]. Interestingly, biallelic inactivation of BACH1 was recently observed in patients with Fanconi Anemia (FA), a recessive chromosomal instability disorder characterized by developmental abnormalities, growth retardation, bone marrow failure, and early predisposition to cancer [15,16]. BACH1 mutations were observed in patients with FA complementation group J, whereas similar inactivation of BRCA2 has been previously observed in patients with FA complementation group D1 [17]. As individuals with a heterozygous BRCA2 mutation are known to have a markedly elevated risk for developing breast cancer, it's tempting to speculate that a similar effect could also be seen with BACH1. In epidemiological studies an excess of breast cancer cases, although statistically non-significant, have been observed among FA heterozygotes [18]. However, this observation needs to be taken cautiously due to the small sample size and lack of analyses of individual complementation groups. In this study, we aimed to evaluate whether there are BACH1 genetic variants that contribute to breast cancer risk by screening the BACH1 gene for germ line alterations among 43 Finnish BRCA1/2 negative breast cancer families. We also evaluated the Ser919Pro variant in a large, independent series of 888 unselected breast cancer patients and in 736 healthy controls.

Methods

Breast cancer patients and healthy controls

Breast cancer patients belonging to 43 breast cancer families with at least three breast or ovarian cancer cases in 1st or 2nd degree relatives and with no detectable BRCA1/2 mutations were included in the initial mutation analysis. Recruitment of the families through the Department of Oncology, Helsinki University Central Hospital, Finland as well as verification of the cancer diagnoses and exclusion of the BRCA1 and BRCA2 mutations have been previously described [19-21]. The BACH1 variant Ser919Pro was analyzed in a large series of unselected breast cancer patients and healthy controls. The 888 unselected breast cancer patients were collected at the Helsinki University Central Hospital, Finland, during April 1997-March 1998 [22] and January-June 2000 [23], and cover 79% of all consecutive, newly diagnosed breast cancer cases during the collection period. DNA samples from altogether 736 healthy females collected at the same geographical region of Southern Finland were studied as healthy population controls. As the variant was associated with an increased breast cancer risk by the age of 50 years [14] the study cohort as well as the population controls were subgrouped according to the menopausal status (age 50 years was chosen as a surrogate for menopause, and patients with cancer diagnosis at < 50 years were considered premenopausal and ≥50 years as postmenopausal). Breast tumor characteristics (tumor histology, size, and grade; nodal and distal metastasis; estrogen and progesterone receptor status) were available from all patients. Additionally, a Val193Ile variant that was found in only one family in the initial mutation analysis was further genotyped in randomly selected series of 346 familial breast cancer patients and in 183 healthy population controls. All mutation analyses have been performed on DNA samples extracted from peripheral blood. The study was performed with informed consent from the patients and under appropriate research permissions from the Ethics Committees of the Departments of Obstetrics and Gynecology, and Oncology, Helsinki University Central Hospital, Finland, as well as Ministry of Social Affairs and Health in Finland.

Mutation analysis

The coding region and exon-intron boundaries of BACH1 were screened using conformation sensitive gel electrophoresis (CSGE) with modifications previously described [24]. Samples with aberrant CSGE profiles were reamplified, and the nucleotide changes determined by direct sequencing. Primers and PCR conditions used in the mutation analysis are presented in table 1. The frequency of the Ser919Pro alteration was determined by Amplifluor™ fluorescent genotyping (K-Biosciences, Cambridge, UK). The genotyping for nt c.2755 (codon 919) was successful in 866/888 (97.5%) breast cancer patient samples and in 731/736 (99.3%) healthy control samples. The Val193Ile (c.577G>A) variant was genotyped in 346 (successful in 336, 97.1%) familial breast cancer samples and in 183 (successful in 167, 91.3%) control samples, respectively, by Amplifluor™ fluorescent genotyping as well.
Table 1

Primers and PCR conditions used in BACH1 mutation analysis.

ExonStrandPrimer nameNucleotide sequence (5'→3')Amplicon lenght (bp)Annealing temperature (°C)
2ForwardEx2FCTGTTTCCAGATTTCTCCC
ReverseEx2RGTGAACCCAGAAAATATTCTCC33158
3ForwardEx3FCCCTGGAGTGCAATCTCACT
ReverseEx3RNTAGCGACAGCATGGCTGAA31948
4ForwardEx4FCCTGGGTGAACTGGGCTGTAG
ReverseEx4RNTAACAGTAATAATTAAGACTC31648
5ForwardEx5FNTTGCCTACCTGTAAGTTATTTATG
ReverseEx5RNACCATGTTCAGCTGTAACTAACTG23360
6ForwardEx6FGAGCTGTTTTGGCCTTTGAGA
ReverseEx6RNCTGAGTGGGTTGCTACTGTCCT31755
7ForwardEx7FGTTCTGATTCCATGTGAGGTT
ReverseEx7RGTACATATAAAACACATACTGAGT44855
8ForwardEx8FGATGTTCCTCAAATTCTGAGATAA
ReverseEx8RCATCTAAAAGCTTTTACATTCAAC38655
9ForwardEx9FGCCTATAGTGTGAATTTTAAAATG
ReverseEx9RCCTAGTTAACCAAAGTTTACTAAC39555
10ForwardEx10FGATCAACGCATGACAATAATGATG
ReverseEx10RGGGTTACTCACTAGATTTAATCTG32055
11ForwardEx11FGCATGTTTTGTTGGGTTTCATTGT
ReverseEx11RGGTATGTATTAAACACATGCTAGC32655
12ForwardEx12FGTACCAGCTCTTTCAAATGAG
ReverseEx12RCTATCTTTAAAAGAGTCAACCAC36055
13ForwardEx13FNGTGCTGGGATTACAGGTGTGAGCCA
ReverseEx13RNACTTGCTGGCACTTCAGGTATCTTC31760
14ForwardEx14FCTTGTTGCTTGATCTTTTATGTAC
ReverseEx14RCTAGGAAGCTTACTGTGGTAA35655
15ForwardEx15FNACAGCTCTATGAGATATATTG
ReverseEx15RNTCATAGGAGAACAAGTACAAT50455
16ForwardEx16FNTTACTTAAAGACATTGAACTT
ReverseEx16RNNCACTATAAAAGCAAAGCGC39254
17ForwardEx17FNCTGTTAGAAGTTAATATGATG
ReverseEx17RNGAATACATACCAGTTCCTATG32555
18ForwardEx18FCCAATTTTCTGTCTGTCCCAC
ReverseEx18RGATAGTAGAGCTCATGTTATGTG25455
19ForwardEx19FCTTCACTAGAAAAAGCAAGTG
ReverseEx19RCCACCATATTTAAGGAATTAATC52348
20AForwardEx20AFNACCTAGCAATTATGTTAGCT
ReverseEx20ARNTCTGTATCTTCAGGATCGTA58448
20BForwardEx20BFNATTGATGCCACCCTTACTA
ReverseEx20BRNNTAACATAAGCATGATGACATA56554

Statistical analysis

Possible associations between the BACH1 Ser919Pro and breast cancer risk, as well as the variant and clinico-pathologic features of the tumors, were tested by univariate analysis. Independent variables were compared with the chi-square test. The mean age at breast cancer diagnoses between the carriers and non-carriers was compared by one-way ANOVA. All p-values were 2-sided, and p-value < 0.01 was considered statistically significant as suggested by Houlston and Peto [25]. All statistical analyses were carried out in the SPSS software (version 12.0 for Windows, SPSS, Chicago, IL, USA).

Results and discussion

Altogether six germ line BACH1 variants were observed in the initial mutation analysis (Table 2). Four of the changes were in the coding region, two of these were missense and two silent substitutions. The missense changes were analyzed further for their possible association with breast cancer risk. The silent alterations have been suggested as neutral polymorphisms by the previous studies [2,26,27], and were not studied here further. The one missense substitution, Val193Ile, was seen in only one family. In addition to the proband diagnosed with breast cancer at the age of 54 years, the variant was also seen in her healthy father and healthy brother, father's sister diagnosed with skin cancer at age 85 years, and the aunts' three children diagnosed with breast cancer at 63 years, ovarian cancer at 59 years, and skin cancer at 64 years, respectively. The grandmother of the proband, whose carrier status is unknown, has been diagnosed with breast cancer at age 74 years. The variant was not observed among 336 familial breast cancer patients or in 167 healthy population controls. It has previously been observed in 3/200 (1.5%) healthy controls and classified as a rare polymorphism [2]. The residue resides in close proximity to the ATP/GTP binding site, and the possible functional significance of this rare variant to BACH1 protein function remains to be determined.
Table 2

Observed germ line variants in BACH1.

Exon/IntronNucleotide changeAmino acid changeFrequency for heterozygotes (%)
int5508-31 C→G-11/43 (25.6)
ex6577 G→AVal193Ile1/43 (2.3)
int142097+7 G→A-1/43 (2.3)
ex192637 G→AGlu879Glu31/43 (72.1)*
ex192755 C→TSer919Pro32/43 (74.4)*
ex203411 C→TTyr1137Tyr27/43 (62.8)*

* also homozygotes for the rare allele

The other observed missense substitution, a common polymorphism Ser919Pro, was associated with an elevated breast cancer risk during the course of this study [14]. In that study the relative cumulative risk by the age 50 years was 4.5 for the female first degree relatives of Pro/Ser heterozygotes (95% CI 0.8–12.2; p = 0.096) and up to 6.9 (95% CI 1.6–29.3; p = 0.018) for the first degree relatives of Ser/Ser homozygotes, when compared to Pro/Pro homozygotes. However, no significant association was seen when the analysis was extended to age 70 years (OR 1.3, 95%CI 0.8–2.8, p = 0.220) [14]. Here we found no association of the variant with breast cancer risk. The odds ratios for the whole study cohort as well as for the pre- and postmenopausal patient groups were close to one both for the Pro/Ser heterozygotes and for the Ser/Ser homozygotes when compared to Pro/Pro homozygotes (Table 3). The alteration did not associate with breast cancer family history (data not shown). No association of the variant with any of the breast tumor characteristics (Table 4) or survival (data not shown) was seen either, and also the age at breast cancer diagnosis was similar in all genotype carrier groups (56.9 years for the Pro/Pro homozygotes, 56.8 years for the heterozygotes, and 56.1 years for the Ser/Ser homozygotes, respectively; p = 0.705). Our data suggest that the BACH1 Ser919Pro alteration is not a breast cancer predisposition allele in our study population although a very low risk effect cannot be excluded. A joint effect on breast cancer risk by the Ser919Pro variant and other epidemiological risk factors may also be possible.
Table 3

Genotypes of the BACH1 Ser919Pro variant among 866 unselected breast cancer patients and 731 healthy population controls.

Cases Controls
n%n%OR*95% CIp
Unselected breast cancer patients, all866731

Pro/Pro18421.214820.21
Pro/Ser42849.438252.30.9010.697–1.1650.427
Ser/Ser25429.320127.51.0160.765–1.3510.911
Pro/Ser + Ser/Ser68278.858379.80.9410.738–1.1200.623
Unselected breast cancer patients, diagnosis <50 years276476

Pro/Pro5620.39620.21
Pro/Ser14050.724952.30.9640.653–1.4230.853
Ser/Ser802913127.51.0470.680–1.6110.835
Pro/Ser + Ser/Ser22079.738079.80.9930.686–1.4360.968
Unselected breast cancer patients, diagnosis ≥50 years590255

Pro/Pro12821.75220.41
Pro/Ser28848.813352.20.8780.600–1.2890.511
Ser/Ser17429.57027.51.0100.660–1.5450.964
Pro/Ser + Ser/Ser46278.320379.60.9250.644–1.3280.671

* as compared to Pro/Pro homozygotes

Table 4

Tumor characteristics of the 909 breast tumors from 866 breast cancer patientsanalyzed for the BACH1 Ser919Pro variant.

BACH1 Ser919Pro

Total n (%)Pro/ProPro/SerSer/Serp
Histology909
Carcinoma ductale713 (78.4)145 (76.3)358 (78.7)210 (79.5)0.480
Carcinoma lobulare130 (14.3)25 (13.2)70 (15.4)35 (13.3)
Carcinoma medullare13 (1.4)5 (2.6)5 (1.1)3 (1.1)
Other53 (5.8)15 (7.9)22 (4.8)16 (6.1)
Tumor grade817
1223 (27.3)51 (29.8)116 (28.2)56 (23.9)0.702
2353 (43.2)73 (42.7)174 (42.2)106 (45.3)
3241 (29.5)47 (27.5)122 (29.6)72 (30.8)
Tumor size, pT887
1545 (61.4)121 (65.8)269 (60.7)155 (59.6)0.423
2282 (31.8)47 (25.5)148 (33.4)87 (33.5)
331 (3.5)7 (3.8)15 (3.4)9 (3.5)
429 (3.3)9 (4.9)11 (2.5)9 (3.5)
Lymph node status, pN909
Negative477 (52.5)104 (54.7)223 (49.0)150 (56.8)0.101
Positive432 (47.5)86 (45.3)232 (51.0)114 (43.2)
Distant Metastasis, pM870
Negative829 (95.3)168 (93.9)416 (96.1)245 (95.0)0.478
Positive41 (4.7)11 (6.1)17 (3.9)13 (5.0)
Estrogen receptor status862
Positive680 (78.9)139 (76.8)339 (78.5)202 (81.1)0.530
Negative182 (21.1)42 (23.2)93 (21.5)47 (18.9)
Pogesterone receptor status863
Positive591 (68.5)129 (70.9)289 (66.9)173 (69.5)0.577
Negative272 (31.5)53 (29.1)143 (33.1)76 (30.5)
Our data, together with previous studies, suggest that germ line mutations in BACH1 do not substantially contribute to the remaining proportion of the familial aggregation of breast cancer outside the high-penetrance genes BRCA1 and BRCA2 [2,26-28]. In the future, it will be interesting to see whether the heterozygous BACH1 mutation carriers in FA families have an excess risk of developing breast or other type of cancer. So far, heterozygous mutations of the FA genes, with the exception of BRCA2, have been found to be extremely rare, or nonexistent, in breast cancer families [29], and the studied polymorphisms have not been found to confer an increased risk for breast cancer [[30], this study].

Conclusion

Taken together, our results are in concordance with previous studies where germ line BACH1 mutations have been observed in only a very few familial breast cancer patients [2,26-28]. This suggests that even though some functionally deleterious germ line BACH1 mutations have been observed in breast cancer patients, such mutations are rare and may account for only a very small proportion, if any, of non-BRCA1/2 familial breast cancer. Our results further indicate that BACH1 Ser919 is not a breast cancer predisposition allele in the Finnish population.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

PV conceived of the study, supervised the molecular genetic studies, performed the statistical analysis and drafted the manuscript. KY and AT carried out the molecular genetic studies. HE and CB collected the patient samples. HN participated in the study design and helped to draft the manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:
  29 in total

1.  Genomic and expression profiling of chromosome 17 in breast cancer reveals complex patterns of alterations and novel candidate genes.

Authors:  Béatrice Orsetti; Mélanie Nugoli; Nathalie Cervera; Laurence Lasorsa; Paul Chuchana; Lisa Ursule; Catherine Nguyen; Richard Redon; Stanislas du Manoir; Carmen Rodriguez; Charles Theillet
Journal:  Cancer Res       Date:  2004-09-15       Impact factor: 12.701

2.  Four regions of allelic imbalance on 17q12-qter associated with high-grade breast tumors.

Authors:  S J Plummer; M J Paris; J Myles; R Tubbs; J Crowe; G Casey
Journal:  Genes Chromosomes Cancer       Date:  1997-12       Impact factor: 5.006

3.  Patterns of allelic loss on chromosome 17 in sporadic breast carcinomas detected by fluorescent-labeled microsatellite analysis.

Authors:  D Niederacher; F Picard; C van Roeyen; H X An; H G Bender; M W Beckmann
Journal:  Genes Chromosomes Cancer       Date:  1997-03       Impact factor: 5.006

4.  Kin-cohort estimates for familial breast cancer risk in relation to variants in DNA base excision repair, BRCA1 interacting and growth factor genes.

Authors:  Alice J Sigurdson; Michael Hauptmann; Nilanjan Chatterjee; Bruce H Alexander; Michele Morin Doody; Joni L Rutter; Jeffery P Struewing
Journal:  BMC Cancer       Date:  2004-03-12       Impact factor: 4.430

5.  A deletion unit on chromosome 17q in epithelial ovarian tumors distal to the familial breast/ovarian cancer locus.

Authors:  I J Jacobs; S A Smith; R W Wiseman; P A Futreal; T Harrington; R J Osborne; V Leech; A Molyneux; A Berchuck; B A Ponder
Journal:  Cancer Res       Date:  1993-03-15       Impact factor: 12.701

6.  Low proportion of BRCA1 and BRCA2 mutations in Finnish breast cancer families: evidence for additional susceptibility genes.

Authors:  P Vehmanen; L S Friedman; H Eerola; M McClure; B Ward; L Sarantaus; T Kainu; K Syrjäkoski; S Pyrhönen; O P Kallioniemi; T Muhonen; M Luce; T S Frank; H Nevanlinna
Journal:  Hum Mol Genet       Date:  1997-12       Impact factor: 6.150

7.  A common region of deletion on chromosome 17q in both sporadic and familial epithelial ovarian tumors distal to BRCA1.

Authors:  A K Godwin; L Vanderveer; D C Schultz; H T Lynch; D A Altomare; K H Buetow; M Daly; L A Getts; A Masny; N Rosenblum
Journal:  Am J Hum Genet       Date:  1994-10       Impact factor: 11.025

8.  Reassessment of cancer predisposition of Fanconi anemia heterozygotes.

Authors:  M Swift; R J Caldwell; C Chase
Journal:  J Natl Cancer Inst       Date:  1980-11       Impact factor: 13.506

9.  Evaluation of Fanconi Anemia genes in familial breast cancer predisposition.

Authors:  Sheila Seal; Rita Barfoot; Hiran Jayatilake; Paula Smith; Anthony Renwick; Linda Bascombe; Lesley McGuffog; D Gareth Evans; Diana Eccles; Douglas F Easton; Michael R Stratton; Nazneen Rahman
Journal:  Cancer Res       Date:  2003-12-15       Impact factor: 12.701

10.  The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations.

Authors:  Sharon Cantor; Ronny Drapkin; Fan Zhang; Yafang Lin; Juliana Han; Sushmita Pamidi; David M Livingston
Journal:  Proc Natl Acad Sci U S A       Date:  2004-02-24       Impact factor: 11.205

View more
  17 in total

Review 1.  G-quadruplex nucleic acids and human disease.

Authors:  Yuliang Wu; Robert M Brosh
Journal:  FEBS J       Date:  2010-07-29       Impact factor: 5.542

Review 2.  Hereditary breast cancer and the BRCA1-associated FANCJ/BACH1/BRIP1.

Authors:  Sharon B Cantor; Shawna Guillemette
Journal:  Future Oncol       Date:  2011-02       Impact factor: 3.404

Review 3.  Does Bach1 & c-Myc dependent redox dysregulation of Nrf2 & adaptive homeostasis decrease cancer risk in ageing?

Authors:  Kelvin J A Davies; Henry Jay Forman
Journal:  Free Radic Biol Med       Date:  2019-01-26       Impact factor: 7.376

4.  Screening for large genomic rearrangements of the BRIP1 and CHK1 genes in Finnish breast cancer families.

Authors:  Szilvia Solyom; Katri Pylkäs; Robert Winqvist
Journal:  Fam Cancer       Date:  2010-12       Impact factor: 2.375

5.  Fanconi anemia group J mutation abolishes its DNA repair function by uncoupling DNA translocation from helicase activity or disruption of protein-DNA complexes.

Authors:  Yuliang Wu; Joshua A Sommers; Avvaru N Suhasini; Thomas Leonard; Julianna S Deakyne; Alexander V Mazin; Kazuo Shin-Ya; Hiroyuki Kitao; Robert M Brosh
Journal:  Blood       Date:  2010-07-16       Impact factor: 22.113

6.  Insight into the roles of helicase motif Ia by characterizing Fanconi anemia group J protein (FANCJ) patient mutations.

Authors:  Manhong Guo; Venkatasubramanian Vidhyasagar; Hao Ding; Yuliang Wu
Journal:  J Biol Chem       Date:  2014-02-25       Impact factor: 5.157

7.  A novel breast cancer-associated BRIP1 (FANCJ/BACH1) germ-line mutation impairs protein stability and function.

Authors:  Arcangela De Nicolo; Mariella Tancredi; Grazia Lombardi; Cristina Chantal Flemma; Serena Barbuti; Claudio Di Cristofano; Bijan Sobhian; Generoso Bevilacqua; Ronny Drapkin; Maria Adelaide Caligo
Journal:  Clin Cancer Res       Date:  2008-07-15       Impact factor: 12.531

8.  Polymorphisms in BRCA1, BRCA1-interacting genes and susceptibility of breast cancer in Chinese women.

Authors:  Xiang Huo; Cheng Lu; Xinen Huang; Zhibin Hu; Guangfu Jin; Hongxia Ma; Xuechen Wang; Jianwei Qin; Xinru Wang; Hongbing Shen; Jinhai Tang
Journal:  J Cancer Res Clin Oncol       Date:  2009-05-31       Impact factor: 4.553

9.  Absence of truncating BRIP1 mutations in chromosome 17q-linked hereditary prostate cancer families.

Authors:  A M Ray; K A Zuhlke; G R Johnson; A M Levin; J A Douglas; E M Lange; K A Cooney
Journal:  Br J Cancer       Date:  2009-11-24       Impact factor: 7.640

10.  Correlation of the BACH1 Pro919Ser polymorphism with breast cancer risk: A literature-based meta-analysis and meta-regression analysis.

Authors:  Jing Shi; Jianhua Tong; Shuang Cai; Xiujuan Qu; Yunpeng Liu
Journal:  Exp Ther Med       Date:  2013-06-07       Impact factor: 2.447

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.