| Literature DB >> 16318629 |
Sonja E N Wagenleiter1, Peter Jagiello, Denis A Akkad, Larissa Arning, Thomas Griga, Wolfram Klein, Jörg T Epplen.
Abstract
Crohn's disease (CD) presents as an inflammatory barrier disease with characteristic destructive processes in the intestinal wall. Although the pathomechanisms of CD are still not exactly understood, there is evidence that, in addition to e.g. bacterial colonisation, genetic predisposition contributes to the development of CD. In order to search for predisposing genetic factors we scrutinised 245 microsatellite markers in a population-based linkage mapping study. These microsatellites cover gene loci the encoded protein of which take part in the regulation of apoptosis and (innate) immune processes. Respective loci contribute to the activation/suppression of apoptosis, are involved in signal transduction and cell cycle regulators or they belong to the tumor necrosis factor superfamily, caspase related genes or the BCL2 family. Furthermore, several cytokines as well as chemokines were included. The approach is based on three steps: analyzing pooled DNAs of patients and controls, verification of significantly differing microsatellite markers by genotyping individual DNA samples and, finally, additional reinvestigation of the respective gene in the region covered by the associated microsatellite by analysing single-nucleotide polymorphisms (SNPs). Using this step-wise process we were unable to demonstrate evidence for genetic predisposition of the chosen apoptosis- and immunity-related genes with respect to susceptibility for CD.Entities:
Mesh:
Substances:
Year: 2005 PMID: 16318629 PMCID: PMC1315346 DOI: 10.1186/1477-5751-4-8
Source DB: PubMed Journal: J Negat Results Biomed ISSN: 1477-5751
Genes investigated for CD association as represented by an intra- or juxtagenic microsatellite marker (for additional information see URL: )
| BPI | |||||
P values for microsatellite markers located intragenically or in the immediate vicinity of represented genes after the initial step and individual genotyping.
| 0.2871 | 0.1936 | 0.0100 | 0.0044 (pc > 0.05; c = 9) | n.s. | |
| 0.0948 | 0.0948 | 0.0275 | n.s. | n.s. | |
| 0.2541 | 0.2541 | 0.0163 | n.s. | n.s. | |
| 0.0011 | 0.0011 | 0.0031 | n.s. | n.s. | |
| 0.0760 | 0.0932 | 0.0100 | n.s. | n.s. | |
| 0.5928 | 0.3535 | 0.0302 | n.s. | n.s. | |
| 0.3004 | 0.3004 | 0.0300 | n.s. | n.s. | |
| 0.0012 | 0.0014 | 0.0014 | 0.0012 (pc < 0.01; c = 6) | n.s. | |
| 0.0083 | 0.0247 | 0.0054 | 0.0050 (pc < 0.04; c = 7) | n.s. | |
P values were generated using three different procedures as described in the methods' section. Briefly, data were analysed by means of contingency tables, initially comparing allele distributions represented by the AIF (after analyses with pooled DNA), then after summation of alleles < 5% in order to focus on the major alleles and, finally, after comparison of each single allele between the control and patient cohorts. For analysing the results of the individual genotyping χ2 testing was utilised.
1Genotyping was performed with the same individuals used in the pooling procedure, and, when remaining significant, further individuals were added to the analyses (FLIP: CD = 134, controls = 150; TNFRSF17: CD = 147, controls = 135; CARD15: CD = 144, controls = 165).
Investigated SNPs in genes as represented by significantly differing microsatellites of the individual genotyping step.
| Rs7583529 | A/C | GGTGATTATTCGGACCCCA/AACTACAGATCCCGTGTGGAG | TseI | 57 | 01: 155 | |
| Rs2041765 | T/C | GAACAAGGAGAGAACCTGGAC/GAGCTGGAAGGCACAGTACA | MboII | 56 | 01: 309 | |
| Rs3743591 | A/G | ATAAGCAGTTTCTGTTTCAGATGT/CTCTACAAGAATTCCAGAGCA | BceAI | 55 | 01: 223 | |
| Rs11570139 | C/T | GCCCTGATATTTACACCCTGT/CAGCCATCTGCAACATGAT | CaiI | 54 | 01: 269 | |
| Rs373496 | T/C | AGGAACTGAAACTCACAATAGC/CAGCTCATTATCTGTCTGATGTT | AluI | 55 | 01: 247 | |
| Rs3087456 | G/A | * 1 GTGAAATTAATTTCAGAG | BfmI | 58 | 01: 268 |
Analyses were performed by using the RFLP method. The table depicts information on the used SNPs as well as RFLP/PCR conditions. * 1 A 5'-tail was added to the mismatch (bold letter) sense primer (5'-CATCGCTGATTCGCACAT-3'). PCR was performed with a third oligonucleotide with the equal sequence as the tail. RE: restriction enzyme; TM: melting temperature (used for annealing in PCR).
Figure 1Genotype frequencies of the microsatellite representing the TNFRSF17 gene. Only genotypes with a frequency of > 0.01 are included. Alleles of the respective microsatellite are indicated as numbers in the X-axis according to their length in bp. For example: 1–1 (read from the number below the numerical series and the first number of the numerical series) means homozygous genotype for microsatellite allele number one and 1–4 heterozygous genotype for allele 1 and 4. Genotypes comprising allele 2 are over-represented within the control group (47% vs. 29%; pc = 0.0042 with c = 2), whereas allele 3 genotypes are more frequent in the patient cohort (58% vs. 52% pc = 0.3130; c = 2). Therefore, allele 2 might imply a protective effect and/or allele 3 a predisposing effect on CD. Interestingly, the genotype 2–3 is more prevalent in the control group. This result can be interpreted by a different effect size of allele 2 (↑) as compared to allele 3, or the significant difference of this microsatellite is only due to linkage of allele 2 with a protective factor.
Allele and genotype frequencies of the functional MHC2TA polymorphism (rs3087456).
| Allele frequencies | p value | OR (CI) | Genotype frequencies | p value | |||
| CD (n = 147) | C | 0.32 | 0.05 | 1.33 (0.90–2.01) | CC | 0.08 | 0.54 |
| T | 0.68 | CT | 0.48 | 0.06 | |||
| TT | 0.44 | 0.03 | |||||
| controls (n = 463) | C | 0.26 | CC | 0.07 | |||
| T | 0.74 | CT | 0.39 | ||||
| TT | 0.54 | ||||||
OR: odds ratio; CI: 95% confidence interval