Literature DB >> 16239639

Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents.

Daekyu Sun1, Kexiao Guo, Jadrian J Rusche, Laurence H Hurley.   

Abstract

The proximal promoter region of the human vascular endothelial growth factor (VEGF) gene contains a polypurine/polypyrimidine tract that serves as a multiple binding site for Sp1 and Egr-1 transcription factors. This tract contains a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif for the formation of an intramolecular G-quadruplex. In this study, we observed the progressive unwinding of the oligomer duplex DNA containing this region into single-stranded forms in the presence of KCl and the G-quadruplex-interactive agents TMPyP4 and telomestatin, suggesting the dynamic nature of this tract under conditions which favor the formation of the G-quadruplex structures. Subsequent footprinting studies with DNase I and S1 nucleases using a supercoiled plasmid DNA containing the human VEGF promoter region also revealed a long protected region, including the guanine-rich sequences, in the presence of KCl and telomestatin. Significantly, a striking hypersensitivity to both nucleases was observed at the 3'-side residue of the predicted G-quadruplex-forming region in the presence of KCl and telomestatin, indicating altered conformation of the human VEGF proximal promoter region surrounding the guanine-rich sequence. In contrast, when specific point mutations were introduced into specific guanine residues within the G-quadruplex-forming region (Sp1 binding sites) to abolish G-quadruplex-forming ability, the reactivity of both nucleases toward the mutated human VEGF proximal promoter region was almost identical, even in the presence of telomestatin with KCl. This comparison of wild-type and mutant sequences strongly suggests that the formation of highly organized secondary structures such as G-quadruplexes within the G-rich region of the human VEGF promoter region is responsible for observed changes in the reactivity of both nucleases within the polypurine/polypyrimidine tract of the human VEGF gene. The formation of the G-quadruplex structures from this G-rich sequence in the human VEGF promoter is further confirmed by the CD experiments. Collectively, our results provide strong evidence that specific G-quadruplex structures can naturally be formed by the G-rich sequence within the polypurine/polypyrimidine tract of the human VEGF promoter region, raising the possibility that the transcriptional control of the VEGF gene can be modulated by G-quadruplex-interactive agents.

Entities:  

Mesh:

Substances:

Year:  2005        PMID: 16239639      PMCID: PMC1266068          DOI: 10.1093/nar/gki917

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


INTRODUCTION

The size of most primary solid tumors is known to be limited to within ∼1–2 mm in diameter because the cancer cells initially rely on pre-existing host blood vessels for a supply of oxygen and nutrients (1). However, starving tumor cells can become angiogenic by gaining the ability to direct the formation of new blood vessels for their survival (2,3). The angiogenic switch in cancer cells is often initiated by increased expression of vascular endothelial growth factor (VEGF), a pluripotent cytokine and angiogenic growth factor (4). VEGF consists of two identical subunits and binds to VEGF receptors on the surfaces of endothelial cells (4). The interaction of VEGF and its cognate receptors stimulates the proliferation, migration, survival and permeability of endothelial cells, resulting in the formation of new blood vessels (5). The formation of new blood vessels adjacent to primary tumor sites promotes the growth of cancer cells by providing oxygen and nutrients. In addition, newly formed blood vessels serve as escape routes for disseminating tumor cells, contributing to tumor metastasis even in locations distant from the primary tumor site (5). The expression of human VEGF, which is frequently elevated in many types of cancer, is mainly regulated at the transcriptional level (6,7). VEGF expression is induced by a variety of factors, including hypoxia, pH, activated oncogenes, inactivated tumor suppressor genes and growth factors (8–15). The molecular basis of VEGF gene expression has been extensively studied by characterizing the cis-acting elements and transcription factors involved in constitutive VEGF expression in human cancer cells (9–14). The human VEGF promoter region contains putative binding sites for several transcription factors, such as HIF-1, AP-1, AP-2, Egr-1, Sp1 and many others, suggesting that they may be involved in VEGF transcriptional regulation (13,14). Functional analysis of the human VEGF promoter using the full-length VEGF promoter reporter revealed that the proximal 36 bp region (−85 to −50 relative to transcription initiation site) is essential for basal or inducible VEGF promoter activity in several human cancer cells (13,14). This region contains at least three Sp1 binding sites, each consisting of a polypurine/polypyrimidine tract (Figure 1). Although there are binding sites for other factors, such as two Egr-1 elements and one AP-2 element, all Sp1 binding sites were found to be functionally significant in constitutive VEGF promoter activity (13,14). Polypurine/polypyrimidine tracts are also found in the promoter region of other growth-related genes, including Hmga-2, EGF-R, c-Myc, I-R, AR, c-Src, c-Ki-Ras, TGF-β, PDGF A-chain, insulin and muscle-specific protein (16–25). These sequences have been proposed to be very dynamic in their conformation, easily adopting non-B-DNA conformations, such as melted DNA, hairpin structures, slipped helices, or others, under physiological conditions (16–25). These sequences also provide landing sites for a transcription machinery complex to initiate transcriptional activation of these genes (26,27). In particular, the guanine-rich sequences found in the polypurine/polypyrimidine tracts are known to form G-quadruplex structures consisting of two or more G-tetrads in the presence of monovalent cations such as Na+ and K+ under physiological conditions as shown in Figure 2A (28,29). Recently, both NMR and X-ray crystallography studies have determined the structures of various forms of G-quadruplexes, and these studies have revealed that folding patterns of these G-quadruplexes depend on the precise arrangement and composition of G-repeats, as well as on the size of the intervening sequences (30–36). Significantly, the polypurine tract of the VEGF promoter consists of five runs of at least three contiguous guanines (GR-I to GR-V in Figure 1) separated by one or more bases, conforming to the general motif capable of forming G-quadruplex structures. Therefore, we hypothesized that the polypurine/polypyrimidine tract of the VEGF promoter region is very dynamic in its structure and can easily adopt a non-B-DNA conformation under physiological conditions. Moreover, we predicted that the G-rich strand of this tract could form specific G-quadruplex structures in the presence of K+ or G-quadruplex-interactive agents.
Figure 1

Polypurine/polypyrimidine sequence located upstream (−89 to −43) of the promoter region of the VEGF gene. Runs of guanines (GR-I through GR-V) are boxed. Binding sites of the transcriptional factors Egr-1 and Sp1 are underlined.

Figure 2

(A) H-bonding pattern in a G-tetrad, (B) schematic diagram of the G-tetrad and (C) cartoon of an 18mer parallel G-quadruplex representing that found in the c-MYC promoter region.

To test our hypothesis, we initially used a DNA breathing assay with an oligomer duplex containing the polypurine/polypyrimidine tract in the VEGF promoter. We anticipated that the unwinding of this oligomer duplex could be facilitated in the presence of G-quadruplex-interactive agents by trapping out and stabilizing the G-quadruplex transiently formed by the G-rich strand of the polypurine/polypyrimidine tract. In addition, we used DNase I and S1 nuclease footprinting to study the structural transition within this tract of the VEGF promoter, since the activity of these enzymes is modulated by DNA conformation (16–18). In this article, we demonstrate that G-quadruplex-interactive agents promote the unwinding of the oligomer duplex containing the polypurine/polypyrimidine tract in the presence of K+. Footprinting experiments with DNase I and S1 nuclease using a supercoiled plasmid containing either the wild-type or mutant VEGF promoters revealed that the emergence of DNase I and S1 nuclease cleavage in the vicinity of the polypurine/polypyrimidine tract was dependent on both the capability of the wild-type sequence to form G-quadruplex structures and the presence of K+ and G-quadruplex-interactive compounds. Collectively, these results support the conclusion that G-quadruplex structures form within this polypurine/pyrimidine tract of the VEGF promoter.

MATERIALS AND METHODS

Drugs, enzymes and oligonucleotide DNA

TMPyP4 was purchased from Midwest Chemicals, and telomestatin was kindly provided by Dr Kazuo Shin-ya (University of Tokyo, Japan). Both drug molecules were dissolved in dimethyl sulfoxide, unless otherwise specified. T4 nucleotide kinase and Taq DNA polymerase were purchased from Promega. PAGE-purified oligonucleotides were obtained from Sigma Genosys.

Polymerase stop assay

The primer DNA (P28) was 5′ end-labeled using T4 polynucleotide kinase with [γ-32P]ATP (3000 Ci/mmol, Perkin Elmer) for 1 h at 37°C and purified on a Bio-Spin 6 chromatography column (BioRad) after inactivation of the kinase by heating at 95°C for 3 min. Labeled primers were annealed to the template DNA and the primer-annealed template DNA was separated from excess labeled primer or remaining template DNA using non-denaturing 8% PAGE. The resulting primer-annealed template DNA was gel-purified and used as a substrate in a primer extension assay by Taq DNA polymerase, as described previously (37).

DNA breathing assay

We designed a 59 bp oligo duplex DNA (59WT) containing the Sp1 binding sites (−101 to −43, relative to transcriptional start site) of the VEGF promoter region (see Figure 3A) in order to study the dynamic features of this promoter region. For the DNA breathing assay, the top strand of 59WT DNA was 5′ end-labeled with 32P and incubated with increasing concentrations of TMPyP4 or telomestatin in 150 mM KCl/TE buffer for 10 h at 37°C. The reaction also contained an 8-fold molar excess of unlabeled top (G-rich) strand as a trap to prevent the released (labeled with 32P) top strands from reannealing, and the DNA was electrophoresed on an 8% native polyacrylamide gel to separate other species of DNA from the duplex form of DNA.
Figure 3

The effect of increasing TMPyP4 and telomestatin concentrations on the conversion of 59mer duplex DNA (59WT) to alternative secondary structures. (A) Nucleotide sequence of 59WT. (B) Structures of TMPyP4 and telomestatin. (C) Autoradiogram of DNA breathing assay. Duplex DNA was titrated with TMPyP4 or telomestatin in 100 mM KCl/TE buffer at 37 or 42°C. Two bands corresponding to Watson–Crick duplex (DS) and single-stranded DNA (S) were identified, along with an isomeric form. (D) Graphical representation of data described in (C).

Plasmid DNA

For in vitro footprinting of the VEGF promoter region, we used the supercoiled form of the luciferase reporter plasmid pGL3-VEGFP, which was constructed by ligating an 837 bp VEGF promoter region (−787 to +50 relative to the transcription initiation site) into the KpnI and NheI sites of pGL3-basic basic vector (Promega, Madison, WI), as described previously (14). This region of the VEGF promoter was found to support the transcription of luciferase expression in human cancer cell lines (14). A mutant reporter plasmid, pGL3-VEGFM17, was constructed by introducing point mutations into specific guanine residues within the Sp1 binding sites of the VEGF promoter regions of pGL3-VEGFP using a QuickChange mutagenesis kit (Stratagene) to destabilize or abolish the G-quadruplex-forming ability of this region.

In vitro footprinting of the VEGF promoter region with DNase I and S1 nuclease

A supercoiled form of each of the plasmids (pGL3-VEGFP and pGL3-VEGFM17) was incubated in the absence of any salt, or in the presence of 100 mM KCl with and without 1 µM telomestatin as a selective G-quadruplex-interactive agent at 37°C for 1 h and then treated with DNase I or S1 nuclease for 2 min. DNA was precipitated with ethanol and resuspended in double-distilled water after vacuum drying. To map DNase I and S1 nuclease cleavage sites on the plasmid DNA, linear amplification by PCR was performed using Thermo Sequenase Cycle Sequencing kit (USB) with 32P-labeled gene-specific primers d(CCCAGCGCCACGACCTCCGAGCTACC) and d(CTGTGAACCTTGGTGGGGGTCGAGC) to amplify the top and bottom strands of the plasmid DNA, respectively.

Circular dichroism spectroscopy

Circular dichroism (CD) spectra were recorded on a Jasco-810 spectropolarimeter (Jasco, Easton, MD), using a quartz cell of 1 mm optical path length, an instrument scanning speed of 100 nm/min, with a response time of 1 s and over a wavelength range of 200–330 or 200–600 nm for the titration experiments with drugs. All DNA samples were dissolved in Tris–HCl buffer (20 mM, pH 7.6) to a strand concentration of 5 µM, and where appropriate, the samples also contained 100 mM KCl. The CD spectra herein are representations of four averaged scans taken at 25°C and are baseline corrected for signal contributions due to the buffer.

RESULTS

Transition of duplex to a non-B-DNA conformation within the polypurine/polypyrimidine tract of the VEGF promoter region in the presence of TMPyP4 and telomestatin

In order to test if the polypurine/polypyrimidine tract of the VEGF promoter region is structurally dynamic and can easily adopt a non-B-DNA conformation under physiological conditions, a DNA breathing assay was carried out with a 59 bp oligomer duplex (59WT) containing the polypurine/polypyrimidine tract (Figure 3A). It was anticipated that the unwinding of the 59WT would occur if Watson–Crick base pairs are destabilized by the formation of non-B-DNA structures in the Sp1 binding sites of the VEGF promoter region. In the DNA breathing assay, the oligomer duplex (59WT) labeled at the 5′ end of the G-rich strand with 32P was incubated with increasing concentrations of the G-quadruplex-interactive agents TMPyP4 (38) or telomestatin (39) (Figure 3B) at 37°C in the presence of 150 mM KCl and then electrophoresed on an 8% native polyacrylamide gel to separate other species of DNA from the duplex form of DNA. G-quadruplex-interactive agents were included to determine if these agents promote the unwinding process by further stabilizing and trapping out the G-quadruplex structures formed by the G-rich strand. As shown in Figure 3C and D, the formation of a single-stranded DNA species was progressively increased as the concentrations of TMPyP4 and telomestatin were increased. TMPyP4 and telomestatin will prevent the conversion back to a B-DNA structure by trapping out and stabilizing the G-quadruplex structures formed in this region of the VEGF promoter. The results from the DNA unwinding study support the idea that the polypurine/polypyrimidine tract of the VEGF promoter region is very dynamic in its structure, and G-quadruplex structures can be formed by the G-rich strand of this tract under physiological conditions of potassium, pH and temperature with the addition of G-quadruplex-stabilizing agents.

In vitro footprinting of the wild-type VEGF promoter contained in a plasmid in the presence of K+ and G-quadruplex-interactive compounds

DNase I and S1 nucleases have been previously used as tools for studying structural transitions occurring in normal B-type DNA (16–18). For example, while DNase I preferentially cleaves locally unwound or normal duplex regions over single-stranded regions, S1 nuclease preferentially cleaves single-stranded regions of DNA over duplex DNA (16–24). However, both enzymes show the lowest cleavage activity toward highly organized secondary structures such as hairpins or G-quadruplex structures. For these reasons, the existence of a non-B-conformation can be implied from changes in the pattern of DNase I and S1 nuclease sensitivity of certain regions of DNA (16–24).

DNase I cleavage

DNase I footprinting was used to determine the possible structural transition from B-DNA to non-B-type DNA structures in the promoter region of the VEGF gene. For the DNase I footprinting, the plasmid pGL3-VEGFP, which contains the VEGF promoter region from −787 to +50, was incubated either in the absence of salt or in the presence of 100 mM KCl, with and without 1 µM telomestatin as the selective G-quadruplex-interactive agent, at 37°C for 1 h and then treated with DNase I for 2 min. DNase I cleavage sites in the plasmids were then mapped using linear amplification by PCR with 32P-labeled gene-specific primers. The primer extension reaction carried out on the top strand of the plasmid revealed a long DNase I protected region located at approximately −53 to −123 bp, which includes the G-rich sequences, when the supercoiled pGL3-VEGFP plasmid was incubated with 100 mM KCl (Figure 4A and B; compare lanes 2 and 3 with lane 1). This result is in accord with a transition from B-DNA to a non-B-DNA structure in the VEGF promoter region, which is most probably a G-quadruplex and consequently resistant to DNase I digestion. Significantly, a striking DNase I hypersensitivity was found at a cytosine located at the 3′-side of the predicted G-quadruplex-forming region in the presence of KCl and telomestatin, which is most probably associated with the junction site between the G-quadruplex and the adjacent normal B-DNA (arrow A in Figure 4A and B). The primer extension reaction of the bottom strand of the plasmid revealed that the reactivity of DNase I on the C-rich region in the VEGF promoter was moderately reduced in the presence of KCl and KCl with telomestatin (Figure 4C; compare lanes 2 and 3 with lane 1). This result suggests that the C-rich sequence and the surrounding region of the VEGF promoter might exist in single-stranded form as a result of the transition of purine-rich strand in the B-type DNA structure to a G-quadruplex under these conditions.
Figure 4

In vitro footprinting of the VEGF promoter region with DNase I. (A) Autoradiograms showing DNase I cleavage sites on the top strand of a supercoiled pGL3-VEGF plasmid. The plasmid DNA was incubated in the absence of salt (lane 1), or in the presence of 100 mM KCl without (lane 2) and with (lane 3) 1 µM telomestatin at 37°C for 1 h before digesting with DNase I. DNase I cleavage sites were mapped using linear amplification by PCR with 32P-labeled gene-specific plasmid DNA pretreated with DNase I. Arrows A and B indicate the hypersensitive cleavage sites to nucleases. (B) Densitometric scanning of the autoradiogram in (A). The bars indicate the guanine repeats involved in the formation of the G-quadruplex structures. Arrows A and B indicate the hypersensitive cleavage sites to nucleases. (C) Autoradiograms showing DNase I cleavage sites on the bottom strand of a supercoiled pGL3-VEGF plasmid. The designation of lanes 1–3 was as in (A) above. DNase I cleavage sites were mapped using linear amplification by PCR with 32P-labeled gene-specific plasmid DNA pretreated with DNase I. The vertical bar next to the gel indicates the polypyrimidine tract.

S1 nuclease cleavage

Since reduced reactivity to DNase I can be caused by either the presence of a single-stranded region or a highly organized secondary structure, such as G-quadruplex structures within the polypurine/polypyrimidine tract of the VEGF promoter, an additional footprinting experiment using S1 nuclease was carried out to obtain further detailed information about the conformational transition occurring in this region. As shown in Figure 5A and B, the reactivity of S1 nuclease on the top strand of the polypurine/polypyrimidine tract of the VEGF promoter was markedly reduced in the presence of KCl with telomestatin. The reduced reactivity of the VEGF promoter region surrounding the G-quadruplex-forming region to both DNase I and S1 nuclease suggests the formation of highly organized secondary structures, such as G-quadruplex structures, rather than the formation of a single-stranded form in the G-rich region of the VEGF promoter in the presence of KCl with telomestatin. Significantly, the hypersensitivity site observed with S1 nuclease also corresponds to that obtained with DNase I in the presence of KCl with telomestatin. The presence of this common hypersensitivity site to both nucleases at the 3′-side of the G-quadruplex-forming region is a strong indicator of the enhanced exposure of this particular residue to both nucleases, suggesting the presence of a junction site between the B-type DNA structure and the G-quadruplex at this site in the promoter region of the VEGF gene. In contrast, the reactivity to S1 nuclease of the opposite strand of the same region was moderately enhanced, with the hypersensitive region extending upstream of the G-rich tract (see arrows in Figure 5C). These results suggest that the opposite strand of the G-rich sequence and the surrounding region of the VEGF promoter exists in a single-stranded form as a result of the transition of B-type DNA structure to the G-quadruplexes under the conditions that favor such transitions.
Figure 5

In vitro footprinting of the VEGF promoter region with S1 nuclease. (A) Autoradiograms showing S1 nuclease cleavage sites on the top strand of a supercoiled pGL3-VEGF plasmid. Arrow A indicates the hypersensitive cleavage sites to S1 nuclease. (B) Densitometric scanning of the autoradiogram in (A). The plasmid DNA was incubated in the absence of salt (lane 1) or in the presence of 100 mM KCl without (lane 2) and with (lane 3) 1 µM telomestatin at 37°C for 1 h before digesting with S1 nuclease. S1 nuclease cleavage sites were mapped using linear amplification by PCR with 32P-labeled gene-specific primers on plasmid DNA pretreated with S1 nuclease. Arrow A indicates the hypersensitive cleavage sites to S1 nuclease. (C) Autoradiograms showing S1 cleavage sites on the bottom strand of a supercoiled pGL3-VEGF plasmid. The designation of lanes 1–3 was as in (A) above. The vertical bar next to the gel indicates the polypyrimidine tract and the arrows indicate the S1 nuclease hypersensitivity sites.

Comparison of the abilities of the G-rich strands of the wild-type versus mutant VEGF promoter sequences to form stable G-quadruplex structures

In order to demonstrate the G-quadruplex-forming ability of the G-rich strand of the polypurine/polypyrimidine tract in the presence of KCl, a DNA polymerase stop assay was used, as previously described (37). This assay provides a simple and rapid way to identify DNA secondary structures, such as G-quadruplexes, in vitro, based on the principle that DNA polymerase is incapable of traversing these structures (37,38). Thus, the DNA polymerase, traversing toward the 5′ end of the template and unable to efficiently resolve quadruplex DNA, pauses or stops 3′ to the first guanine involved in a stable G-quadruplex. When a DNA template (WT) containing the G-quadruplex-forming region [d(G4CG3C2G5CG4)] was annealed with 32P-labeled primers and incubated with Taq DNA polymerase, a potassium-dependent pause of the DNA polymerase extension was observed with this DNA template (Figure 6A). In contrast, in the absence of KCl, the DNA polymerase bypasses the G-repeat region. The KCl-dependent pausing is observed immediately 3′ to the fourth guanine run (GR-IV), presumably through stabilization of the intramolecular G-quadruplex structure, confirming that this region is indeed capable of forming intramolecular G-quadruplex structures (Figure 6A). A potassium-dependent pausing of DNA polymerase extension was not observed in the mutant DNA template (MT), in which mutations were introduced into the G-quadruplex-forming region to abolish the formation of G-quadruplex structures (Figure 6B).
Figure 6

DNA polymerase stop assay to determine the ability of the VEGF promoter to form G-quadruplex structures. (A and B) The wild-type (WT) and mutant (MT) template sequences (shown below the gels) with increasing concentrations of K+ (0–100 mM). Arrows indicate the positions of the full-length product (F) of DNA synthesis, the G-quadruplex pause site (S), and the free primer (P). Lanes A, G, T and C represent dideoxy sequencing reactions with the same template as a size marker for the precise arrest sites.

In vitro footprinting of the mutant VEGF promoter region with DNase I and S1 nuclease

The importance of the G-quadruplex-forming ability of the polypurine/polypyrimidine tract in causing the change in the reactivity of both nucleases in the presence of KCl and telomestatin was determined using the mutant reporter plasmid pGL3-VEGFM17. This plasmid contains the same point mutations in the specific guanine residues within the G-quadruplex-forming region of the VEGF promoter as those shown in Figure 6B to destabilize or abolish the G-quadruplex-forming ability of this region. For in vitro footprinting, the supercoiled form of the mutant plasmid pGL3-VEGFM17 was incubated under the same conditions and with the same enzymes used in the previous experiments shown in Figures 4 and 5. As shown in Figure 7, the reactivity of both nucleases toward the mutated VEGF proximal promoter region was little changed in the presence of telomestatin with KCl, and the hypersensitivity site was not observed with both nucleases in the presence of telomestatin with KCl. This result provides strong support for the idea that the formation of highly organized secondary structures, such as G-quadruplex structures, within the G-rich region of the VEGF promoter region is responsible for observed changes in the DNase I and S1 cleavage reactivity of the polypurine/polypyrimidine tract in the human VEGF promoter sequence.
Figure 7

In vitro footprinting of the mutant VEGF promoter region with DNase I and S1 nuclease. Autoradiograms showing DNase I (lanes 1–3) and S1 (lanes 4–6) cleavage sites on the top strand of a supercoiled pGL3-VEGFM17 plasmid. This plasmid was incubated in the absence of salt (lanes 1 and 4) or in the presence of 100 mM KCl without (lanes 2 and 5) and with (lanes 3 and 6) 1 µM telomestatin at 37°C for 1 h before digesting with nucleases. Nuclease cleavage sites were mapped using linear amplification by PCR with 32P-labeled gene-specific primers on mutant plasmid DNA pretreated with S1 nuclease or DNase I.

CD spectra of the G-rich strand in the VEGF promoter reveals a parallel-stranded G-quadruplex

CD spectroscopy has been widely used to infer the presence of G-quadruplexes and is particularly useful for differentiating parallel and antiparallel G-quadruplexes (40,41). All guanosines in the structure of a parallel quadruplex have an anti-conformation of the glycosyl bonds, resulting in a positive band at ∼265 nm and a small negative band at ∼245 nm in CD spectrum (40,41). In contrast, the guanosines in an antiparallel quadruplex have alternating syn and anti glycosyl conformations along each strand, exhibiting a positive band at ∼295 nm that is associated with an antiparallel strand arrangement. The oligonucleotide used in CD studies was VEGF-PuT, d(T5G3CG3C2G5CG3T5), which contains a potential G-quadruplex forming region [d(G3CG3C2G5CG3)] of the G-rich strand in the VEGF promoter. As shown Figure 8, the CD spectra of this sequence displays the characteristic signature for the parallel-type of G-quadruplex in the presence of increasing concentration of KCl, exhibiting a positive band at ∼265 nm and a small negative band at ∼245 nm.
Figure 8

CD spectra of the VEGF-Pu20T, d(T5G3CG3C2G5CG3T5), in Tris–HCl buffer (20 mM, pH 7.6) in the presence of increasing concentrations of KCl (0, 10, 50 and 100 mM). Each spectrum corresponds to four averaged scans taken at 25°C and is baseline corrected for signal contributions due to the buffer.

DISCUSSION

The proposed transition of B-DNA into non-B-DNA structures, such as melted DNA, hairpin structures, slipped helices or others, has been reported in a number of growth-related mammalian genes, including Hmga2, EGF-R, c-Myc, malic enzyme, I-R, AR, c-Src, c-Ki-Ras, TGF-β, sMtCK, α7 integrin and PDGF A-chain (16–25). Significantly, the polypurine/polypyrimidine tracts are often found in the proximal promoter region of these genes, implicating the importance of structural transitions in these DNA tracts in mediating transcriptional regulation of these genes (16–24). In general, DNA unwinding at the proximal promoter region of both prokaryotic and eukaryotic genes is believed to enhance open promoter complex formation with transcriptional machineries leading to transcriptional activation of the genes (26,27). A polypurine/polypyrimidine tract was also found within the proximal promoter region of the VEGF gene, the gene product of which is an angiogenic growth factor. This tract is known to serve as a multiple binding site for Sp1 and Egr-1 transcription factors (13,14). The polypurine tract of the VEGF promoter region contains a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases. This guanine-rich sequence conforms to a general motif capable of forming an intramolecular G-quadruplex: GNGNGNG, where x ≥ 3 and y ≥ 1 (28,29). Therefore, in this study, we were interested in addressing whether a conformational transition exists among B-type DNA, melted DNA and G-quadruplex structures within this tract in the VEGF promoter, and whether specific G-quadruplex structures can naturally form from the guanine-rich sequence of this tract in the presence of KCl and/or G-quadruplex-interactive agents. We anticipated that the results of this study would enhance our understanding of the role of DNA structure in transcriptional regulation of the VEGF gene. Furthermore, we wished to explore a new therapeutic strategy to treat tumor angiogenesis by repressing the transcriptional activation of a major angiogenic gene, VEGF, by modification or stabilization of non-canonical DNA structures such as G-quadruplexes with G-quadruplex-interactive drugs. In this report, the dynamic nature of a polypurine/polypyrimidine tract of the VEGF promoter region has been demonstrated through a DNA breathing assay using the oligomer duplex DNA containing this tract. Both TMPyP4 and telomestatin, which are two representative G-quadruplex-interactive agents, were found to promote the unwinding of this oligomer duplex in the presence of KCl (150 mM) under physiological conditions (see Figure 3). We propose that these agents can trap out and stabilize the G-quadruplex structures that are transiently formed from the unwound G-rich strand of the 59mer duplex, facilitating the unwinding of the oligomer duplex into single-stranded forms. The destabilization of the proximal region of the VEGF promoter may contribute to the transcriptional activation of the VEGF gene by providing the binding site for transcriptional machinery, including transcriptional factors (e.g. CNBP or hnRNP, which are single-stranded DNA-binding proteins) and RNA polymerase in the TATA-less promoter region (40). The results from our footprinting studies using DNase I and S1 nuclease also demonstrate that the VEGF promoter region including the guanine-rich sequences adapts an unusual DNA conformation. In general, locally unwound or normal duplex regions are preferentially cleaved by DNase I over single-stranded regions or highly organized secondary structures such as hairpins or G-quadruplex structures (16–18). In contrast, S1 nuclease prefers to cleave single-stranded or locally unwound regions of duplex DNA over normal duplex and highly organized secondary structures. Therefore, the combined use of both nucleases in in vitro footprinting experiments is expected to reveal pertinent information about unusual structural features of defined elements within the global region of DNA duplex molecules. A summary of the results from the DNase I and S1 nuclease footprinting experiments is shown in Figure 9. The DNA cleavage results from our footprinting studies revealed a long protected region including the guanine-rich sequences by both nucleases in the presence of KCl and telomestatin, which are known to facilitate the transition of B-type DNA structures to G-quadruplexes. Significantly, a striking hypersensitivity to both nucleases was observed at the 3′ side residue of the predicted G-quadruplex-forming region in the presence of KCl and telomestatin, indicating an altered conformation of the VEGF proximal promoter region surrounding the guanine-rich sequence. It is important to note that the identical changes in footprinting patterns by both nucleases in the presence of KCl are significantly enhanced by the presence of the G-quadruplex-interactive agent telomestatin, suggesting that telomestatin interacts with G-quadruplex structure(s) formed by the G-rich sequence within the polypurine/polypyrimidine region. Finally, since specific point mutations introduced into specific guanine residues within the G-quadruplex-forming region abolished G-quadruplex-forming ability, and correspondingly, the reactivity of both nucleases toward the mutated VEGF proximal promoter region was little changed, even in the presence of telomestatin with KCl, these results also provide solid evidence that the formation of G-quadruplex structures within the G-rich region of the VEGF promoter region is responsible for observed changes in the reactivity of both nucleases within the polypurine/polypyrimidine tract of the human VEGF gene.
Figure 9

Summary of the results from both DNase I and S1 nuclease footprinting (Figures 4 and 5). The arrow heads and filled circles indicate the hypersensitive sites to S1 nuclease and DNase I, respectively.

The result from CD spectroscopy suggests that the secondary structures formed by the G-rich strand, d(G4CG3C2G5CG4), of the VEGF promoter could be the parallel type of intramolecular G-quadruplex. Our electrophoretic mobility shift assay indicated that this sequence predominantly formed an intramolecular G-quadruplex structure in the presence of KCl (D. Sun, unpublished data). The structure of G-quadruplexes formed by this oligonucleotide is predicted to be very similar to that found in the C-MYC G-quadruplex structures (34). In this mutant sequence derived from the NHEIII1 in the c-MYC promoter, the central run of guanines is substituted in the four thymines (34). This structure involves a core of three stacked G-tetrads formed by four G-stretches and three loops bridging three G-tetrad layers (34). The central loop contains six residues, while the two other loops contain only one residue. Previous studies reported that certain types of G-rich sequences are capable of forming parallel or antiparallel G-quadruplex structures consisting of two or more G-tetrads in the presence of monovalent cations such as Na+ and K+. G-rich sequences capable of forming G-quadruplexes have been reported in telomeric sequences, immunoglobulin switch regions, the insulin gene, the control region of the retinoblastoma susceptibility gene, the promoter region of the c-Myc gene, fragile X syndrome triplet repeats, and HIV-1 RNA [(reviewed in (36)] and muscle-specific protein (25). Recently, the solution structure of the parallel G-quadruplex in the c-Myc promoter was determined (35). Direct evidence for the existence of G-quadruplexes in vivo is beginning to emerge, and the ability of these important sequences to form very stable G-quadruplex structures in vitro suggests that G-quadruplex DNA may play an important role in several biological events (34). For instance, a recent study provided compelling evidence that a specific G-quadruplex structure formed in the c-Myc promoter functions as a transcriptional repressor element, establishing the principle that c-Myc transcription could be controlled by ligand-mediated G-quadruplex stabilization (42). Analogous to the c-Myc gene, the transcription of the VEGF gene could be regulated by the G-quadruplex structures formed by the G-rich sequence within the polypurine/polypyrimidine tract of the promoter region. G-quadruplex structures could inhibit the interaction of transcriptional factors (e.g. Sp1) with their cognate sites if those sites overlap the G-quadruplex-forming region. Alternatively, the formation of G-quadruplex structures could induce DNA bending at the junction sites between G-quadruplex structures and normal B-DNA structures, potentially leading to the activation or repression of transcription. Future studies are directed toward addressing whether mutation of sequences of the polypurine/polypyrimidine tract could lead to transcriptional repression (or activation) of the VEGF promoter, and if the G-quadruplex-forming ability of this region correlates with the promoter activity of the VEGF genes. In summary, our results provide strong evidence that specific G-quadruplex structures can naturally be formed by the G-rich sequence within the polypurine/polypyrimidine tract of the VEGF promoter region, raising the possibility that the transcription of this gene can be controlled by ligand-mediated G-quadruplex stabilization.
  42 in total

Review 1.  Secondary DNA structures as molecular targets for cancer therapeutics.

Authors:  L H Hurley
Journal:  Biochem Soc Trans       Date:  2001-11       Impact factor: 5.407

2.  Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular g-quadruplex.

Authors:  Mu-Yong Kim; Hariprasad Vankayalapati; Kazuo Shin-Ya; Konstanty Wierzba; Laurence H Hurley
Journal:  J Am Chem Soc       Date:  2002-03-13       Impact factor: 15.419

3.  Crystal structure of parallel quadruplexes from human telomeric DNA.

Authors:  Gary N Parkinson; Michael P H Lee; Stephen Neidle
Journal:  Nature       Date:  2002-05-26       Impact factor: 49.962

4.  A polypyrimidine/polypurine tract within the Hmga2 minimal promoter: a common feature of many growth-related genes.

Authors:  Alessandra Rustighi; Michela A Tessari; Fulvia Vascotto; Riccardo Sgarra; Vincenzo Giancotti; Guidalberto Manfioletti
Journal:  Biochemistry       Date:  2002-01-29       Impact factor: 3.162

5.  Stimulation of vascular endothelial growth factor gene transcription by all trans retinoic acid through Sp1 and Sp3 sites in human bronchioloalveolar carcinoma cells.

Authors:  Toshitaka Maeno; Toru Tanaka; Yoshichika Sando; Tatsuo Suga; Yuri Maeno; Junichi Nakagawa; Tatsuya Hosono; Mahito Sato; Hideo Akiyama; Shoji Kishi; Ryozo Nagai; Masahiko Kurabayashi
Journal:  Am J Respir Cell Mol Biol       Date:  2002-02       Impact factor: 6.914

6.  Selective interactions of cationic porphyrins with G-quadruplex structures.

Authors:  H Han; D R Langley; A Rangan; L H Hurley
Journal:  J Am Chem Soc       Date:  2001-09-19       Impact factor: 15.419

7.  Central role of p53 on regulation of vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) expression in mammary carcinoma.

Authors:  S Pal; K Datta; D Mukhopadhyay
Journal:  Cancer Res       Date:  2001-09-15       Impact factor: 12.701

Review 8.  CD of single-stranded, double-stranded, and G-quartet nucleic acids in complexes with a single-stranded DNA-binding protein.

Authors:  Donald M Gray; Carla W Gray; Tung-Chung Mou; Jin-Der Wen
Journal:  Enantiomer       Date:  2002 Mar-Jun

9.  Crystal structure of the potassium form of an Oxytricha nova G-quadruplex.

Authors:  Shozeb Haider; Gary N Parkinson; Stephen Neidle
Journal:  J Mol Biol       Date:  2002-07-05       Impact factor: 5.469

View more
  155 in total

1.  Resolution of quadruplex polymorphism by size-exclusion chromatography.

Authors:  M Clarke Miller; John O Trent
Journal:  Curr Protoc Nucleic Acid Chem       Date:  2011-06

2.  Polymorphism and resolution of oncogene promoter quadruplex-forming sequences.

Authors:  M Clarke Miller; Huy T Le; William L Dean; Patrick A Holt; Jonathan B Chaires; John O Trent
Journal:  Org Biomol Chem       Date:  2011-09-21       Impact factor: 3.876

Review 3.  Targeting DNA G-quadruplex structures with peptide nucleic acids.

Authors:  Igor G Panyutin; Mykola I Onyshchenko; Ethan A Englund; Daniel H Appella; Ronald D Neumann
Journal:  Curr Pharm Des       Date:  2012       Impact factor: 3.116

4.  Solution structure of a 2:1 quindoline-c-MYC G-quadruplex: insights into G-quadruplex-interactive small molecule drug design.

Authors:  Jixun Dai; Megan Carver; Laurence H Hurley; Danzhou Yang
Journal:  J Am Chem Soc       Date:  2011-10-14       Impact factor: 15.419

5.  Molecular cloning of the human platelet-derived growth factor receptor beta (PDGFR-beta) promoter and drug targeting of the G-quadruplex-forming region to repress PDGFR-beta expression.

Authors:  Yong Qin; Jessica S Fortin; Denise Tye; Mary Gleason-Guzman; Tracy A Brooks; Laurence H Hurley
Journal:  Biochemistry       Date:  2010-05-18       Impact factor: 3.162

6.  Downregulation of the WT1 gene expression via TMPyP4 stabilization of promoter G-quadruplexes in leukemia cells.

Authors:  Saeedeh Ghazaey Zidanloo; Abasalt Hosseinzadeh Colagar; Hossein Ayatollahi; Jahan-Bakhsh Raoof
Journal:  Tumour Biol       Date:  2016-01-27

7.  Formation of pseudosymmetrical G-quadruplex and i-motif structures in the proximal promoter region of the RET oncogene.

Authors:  Kexiao Guo; Alan Pourpak; Kara Beetz-Rogers; Vijay Gokhale; Daekyu Sun; Laurence H Hurley
Journal:  J Am Chem Soc       Date:  2007-08-02       Impact factor: 15.419

8.  An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution.

Authors:  Jixun Dai; Thomas S Dexheimer; Ding Chen; Megan Carver; Attila Ambrus; Roger A Jones; Danzhou Yang
Journal:  J Am Chem Soc       Date:  2006-02-01       Impact factor: 15.419

9.  Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

Authors:  Daekyu Sun; Laurence H Hurley
Journal:  Methods Mol Biol       Date:  2010

10.  The i-motif in the bcl-2 P1 promoter forms an unexpectedly stable structure with a unique 8:5:7 loop folding pattern.

Authors:  Samantha Kendrick; Yoshitsugu Akiyama; Sidney M Hecht; Laurence H Hurley
Journal:  J Am Chem Soc       Date:  2009-12-09       Impact factor: 15.419

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.