| Literature DB >> 16107212 |
Hutokshi K Buhariwalla1, B Jayashree, K Eshwar, Jonathan H Crouch.
Abstract
BACKGROUND: Chickpea is a major crop in many drier regions of the world where it is an important protein-rich food and an increasingly valuable traded commodity. The wild annual Cicer species are known to possess unique sources of resistance to pests and diseases, and tolerance to environmental stresses. However, there has been limited utilization of these wild species by chickpea breeding programs due to interspecific crossing barriers and deleterious linkage drag. Molecular genetic diversity analysis may help predict which accessions are most likely to produce fertile progeny when crossed with chickpea cultivars. While, trait-markers may provide an effective tool for breaking linkage drag. Although SSR markers are the assay of choice for marker-assisted selection of specific traits in conventional breeding populations, they may not provide reliable estimates of interspecific diversity, and may lose selective power in backcross programs based on interspecific introgressions. Thus, we have pursued the development of gene-based markers to resolve these problems and to provide candidate gene markers for QTL mapping of important agronomic traits.Entities:
Mesh:
Substances:
Year: 2005 PMID: 16107212 PMCID: PMC1215491 DOI: 10.1186/1471-2229-5-16
Source DB: PubMed Journal: BMC Plant Biol ISSN: 1471-2229 Impact factor: 4.215
Figure 1A summary of the number of EST clones and respective gene contigs classified in various functional categories based on alignments with public databases. Putative identifications were assigned to 2130 of the 2858 sequences generated from a chickpea root subtractive hybridization library. Percentages indicate the proportion of unigenes from the total number of unigenes identified in whole dataset.
Characteristics of chickpea EST markers developed from EST root library with primer sequence, GenBank accession numbers, PCR optimized parameters including touch down amplification profile.
| TGTCAGACTGAGCTGTGTATGAGA | TTGCCCGTATGGTTATGTTAGGAA | CK148953* | 55–45 | 0.3 | 1.5 | 0.15 | 0.3 | |
| GACCCCCAAAAATGAAAAAGCA | TTGCCCATACATTCTTCACCCAA | CK148966 | 60–55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| CAAACTCCTCAATAGCAGGCACA | GCTGTATCGGAGAGTGGTCAGA | CK149041* | 55–45 | 0.3 | 1.5 | 0.15 | 0.3 | |
| ACTCCTGTAGTGGCATATCTTCGA | TGGTCCATTTATGCCGCTGGTA | CK148709 | 60–55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| GCAGCAACTATTTACACTGGTA | CTCTCTGGGAGAAAGCTCGGAA | CK149086* | 60-55 | 0.45 | 1.5 | 0.15 | 0.3 | |
| ACTGATCAAGGTCTCTTCTAGACA | CCCAACAAACTGGACAAAGCAGA | CK149086* | 60-55 | 0.45 | 1.5 | 0.15 | 0.3 | |
| GAGTACTTGCCAACTAGCTTAGGA | TTGGATATAACAGATGACGGGGAA | CK149087* | 60-55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| GCATCCTTCCCACTTCTTTGCA | GAATGGACTCGGATGTCTTAAGCA | CK148924* | 60-55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| AATGGTGATTCGTCAGTCGCCTA | CTGTCTGAAGAAAGTGAACGAA | CK148978* | 60-55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| CAAATTTCTGTTCTTCCACCCCAA | GGCGATCTTCGAGTCCATCGA | CK148933 | 60-55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| GCTAAACCTTAGAGCAATGACTCA | CCTTGCTTGTGCCTTATCTTCCA | CK148934 | 60-55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| TCTTCAACACCTCCATCTAACCTA | GACATGAAACCAAAGCATCACA | CK148945* | 60-55 | 0.3 | 1.5 | 0.15 | 0.3 | |
| CTTTACCAAAACCACCTTCACCAA | TCTCTCTCTCTCTCTTCTGTTCCA | CK149140* | 60-55 | 0.5 | 1.5 | 0.15 | 0.3 | |
| GCCGAGGTACACTTTACCAA | TCCTCACACTTCAGGTTCAACGA | CK149136 | 55-45 | 0.5 | 1.5 | 0.15 | 0.3 | |
| CTCCTCTTCTCCGTCGTAGCA | CTGGTCCTTGACGGGAGTGA | CK149070* | 65-60 | 0.5 | 1.5 | 0.15 | 0.3 | |
| GTTTACATCATGACCCGCCCTA | TCACCAAGACCAGAACGTTCCA | CK148819 | 60-55 | 0.5 | 1.5 | 0.15 | 0.3 | |
| TGCCCAACGGTTTCTTTTACCA | TCAGAGATACTCGCCCACCAA | CK148960 | 55-45 | 0.5 | 1.5 | 0.15 | 0.3 | |
| TCTTTGAGCAGCATTCATTCCACA | GAGTGCTACCTTCAAAGACTGCA | CK148677 | 55-45 | 0.5 | 1.5 | 0.15 | 0.3 | |
| CGATCAAGAACCCAGTTTTGCAA | AAGATCGACAGGCGATCTGGTA | CK148718 | 55-45 | 0.5 | 1.5 | 0.15 | 0.3 | |
| CACTCTCCGTTCCGGTTCCA | CTGTCCATGCCCTTGTCCA | CK148806 | 60-55 | 0.3 | 1.5 | 0.2 | 0.5 | |
| CAGGTCGCGTTGTTGCA | GGCCGAGGTACACTTTTCCA | CK149133* | 60-55 | 0.5 | 2 | 0.1 | 0.3 | |
| TTCATCTGGCACTAGCATATCTGA | CGACAATTCTTGCTTCAACAACCA | CK148900* | 60-55 | 0.3 | 2 | 0.1 | 0.3 | |
| CATGTTTTCTACCCTCACAATGCA | TACTCACTTGTTGTTCCAGACA | CK149124* | 55-45 | 0.2 | 1 | 0.1 | 0.2 | |
| TTCGATCCTCCGACCCCGAA | TTCGCTAGATCTGGATACTTCTCA | CK148802 | 60-55 | 0.3 | 2 | 0.1 | 0.3 | |
| TCTTCTTCTTCTTCTTCAGCCACA | GTGGATTGGGAAATGTGAATGTCA | CK149128* | 55-45 | 0.2 | 1 | 0.1 | 0.2 | |
| CCACAAAGGACGACAACAACGA | CCCAACACGAACCACACGA | CK149070 | 60-55 | 0.2 | 2 | 0.2 | 0.5 | |
| ATCCATCACAACCCTCAACTCA | CTCCGTCAACCTTTCCGCAA | CK149102* | 55-45 | 0.3 | 2 | 0.1 | 0.3 | |
| TGTTGTCTCGCCAATTCAAAGCA | CGTTTGGTGGCATTCCTGCA | CK148906* | 55-45 | 0.3 | 2 | 0.1 | 0.3 | |
| TTTAATTACGCGGTTTCCACGA | GAAGACTTGAGACATGGGCACA | CK148928* | 55-45 | 0.2 | 1 | 0.1 | 0.2 | |
| CGTGGGATTGAAAAAGTTGCTA | CACTACCAGCCAAAGCACTCA | CK149006* | 55-45 | 0.2 | 1 | 0.1 | 0.2 | |
| CAACAACAACCTATCCGAACCTCA | ACTATCCCTAACCTTCCATCACCA | CK148853 | 60-55 | 0.5 | 1 | 0.2 | 0.5 | |
| CATGAGTGGTAGTGGGAGTGGA | GTTCGTTTGAGTCGTTTACTGGAA | CK148862 | 60-55 | 0.2 | 2 | 0.2 | 0.5 | |
| TCAACAACGCTACCCGATCCAA | TTCTCAAGAGCACCACAAAAGAGA | CK149132 | 60-55 | 0.3 | 2 | 0.1 | 0.3 | |
| CGGCGGCTATATTGGTTTTGCA | TCCTAAACCCCACTTATCTCCCTA | CK149080* | 60-55 | 0.3 | 2 | 0.1 | 0.3 | |
| TTTGTGATGGTCCTGCTCTCTCA | ACCGCTTCAGGATCAACTCGA | CK148871 | 60-55 | 0.3 | 2 | 0.1 | 0.3 | |
| TCTTCCGATCCTAAGAAAGAGCAA | ACCAATATGGAGAGCACCAGTCA | CK148894 | 60-55 | 0.3 | 2 | 0.1 | 0.3 | |
| CCACCTTCCATCTCCAATTCCAA | GACTGAATCGGAGAAGGTTTCTCA | CK149089 | 60-55 | 0.15 | 2 | 0.1 | 0.2 | |
| CCAGCTTCTAATGTAGGTCTGCA | CAGCAGCAGCAGAGAGAGCA | CK148761 | 60-55 | 0.15 | 1 | 0.1 | 0.2 | |
| ACTTGGGCGTTCAAAAATCTCA | CCATTACGATCAAAGAGCTCAGGA | CK148768 | 55-45 | 0.3 | 2 | 0.1 | 0.3 | |
| GTCCGAGCTGTGGATAGGGAA | GTTCCGCCTTCAATCCATGGAA | CK148904* | 60-55 | 0.2 | 2 | 0.2 | 0.5 | |
| CCAACTTCCCTCATTCTTATTCCA | ACCAATTCCAAATTTCCAGCTCGA | CK149093 | 55-45 | 0.2 | 1 | 0.1 | 0.2 | |
| TCCATATGGCTGAAGAACCCCAA | TTCTGAGGTTCAGGTAGTTCGGAA | CK149016* | 60-55 | 0.2 | 2 | 0.2 | 0.5 | |
| CTCTTTCTTTCCCTCTAGTTTCCA | CGGCGAACTCGTGTTTGCTA | CK149016 | 55-45 | 0.2 | 1 | 0.1 | 0.2 | |
| TGTCCAAAATTGGGATCAGAGA | AGAACGACTTCAGCAGCAGCA | CK148993* | 55-45 | 0.3 | 2 | 0.1 | 0.3 | |
*Genbank accession numbers of the longest EST sequence of the contig, used in primer design.
Figure 2Polymorphic profiles of EST primers AGLC34, AGLC45, AGLC51 and AGLC52 screened on representatives of 8 wild species (IG69947, IG69960, IG69961, IG69974, IG69976, IG69986, IG69992, IG70029, ICC17116, ICC17121, ICC17122, ICC17126, ICC17141, ICC17148) and one cultivated genotype (ICC4958), separated by 6% non-denatured polyacrylamide gel electrophoresis and visualized by silver staining.
Characteristics of chickpea EST markers including SSR motif where present, annotation information (NSH indicates no significant homology), and, size range of amplification products, number of alleles and PIC (polymorphism information content) values based on screening of germplasm in Table 1.
| AGLC2 | Valyl tRNA synthetase | 620 | 2 | 0.50 | |
| AGLC7 | D-3-phosphoglycerate dehydrogenase | 330–335 | 2 | 0.44 | |
| AGLC8 | RNA helicase | 525–550 | 5 | 0.78 | |
| AGLC9 | Unknown protein | 680 | 4 | 0.62 | |
| AGLC14 | Hypothetical protein | 520–600 | 2 | 0.45 | |
| AGLC15 | Hypothetical protein | 520–600 | 4 | 0.65 | |
| AGLC16 | WD-repeat protein like | 365–370 | 2 | 0.32 | |
| AGLC19 | Formin-like protein | 350–355 | 4 | 0.50 | |
| AGLC20 | Type IIB calcium ATPase | 230–235 | 3 | 0.61 | |
| AGLC27 | Putative Scarecrow gene regulator | 330–335 | 3 | 0.43 | |
| AGLC28 | Type 2A protein phosphatase | 335–350 | 3 | 0.86 | |
| AGLC29 | Non-specific lipid transfer protein | 325–400 | 6 | 0.64 | |
| AGLC34 | AG(20) | Putative protein kinase | 350–600 | 5 | 0.75 |
| AGLC39 | AG(17) | No significant homology | 275–290 | 3 | 0.74 |
| AGLC45 | Probable cysteine proteinase (EC 3.4.22.-) | 410–420 | 2 | 0.29 | |
| AGLC47 | (NM_127184) putative beta-ketoacyl-CoA synthase | 200–210 | 2 | 0.59 | |
| AGLC48 | Putative peroxisome assembly factor-2 (NM_100181) | 400–410 | 3 | 0.89 | |
| AGLC51 | RNA binding protein | 170–180 | 4 | 0.55 | |
| AGLC52 | Protein kinase | 390–410 | 6 | 0.89 | |
| AGLC53 | Acyl- [acyl-carrier protein] desaturase | 390–400 | 5 | 0.87 | |
| AGLC55 | CT(17) | Putative protein kinase | 225–275 | 4 | 0.89 |
| AGLC57 | GGA(3) | Unknown protein; protein | >1000 | 3 | 0.56 |
| AGLC60 | TTC(3) | Hypothetical protein | 310–350 | 7 | 0.82 |
| AGLC61 | GAA(3) | Protein of unknown function | 450–470 | 5 | 0.55 |
| AGLC64 | TTC(6) | No significant homolgy | 270–360 | 4 | 0.20 |
| AGLC66 | Probable cysteine protenase (EC 3.4.22.-) | 500–650 | 8 | 0.63 | |
| AGLC67 | TCT(4) | Tryptophan synthase beta-subunit (TSB2) | >1000 | 4 | 0.56 |
| AGLC68 | Lon protease homolog 1 precursor | 220–230 | 3 | 0.39 | |
| AGLC72 | Putative Grr1 protein | 230–250 | 4 | 0.62 | |
| AGLC74 | TTTA(3) | Glycosyl hydrolase family 17 | 400–450 | 5 | 0.75 |
| AGLC75 | AAC(5) | No significant homology | 200–230 | 3 | 0.48 |
| AGLC76 | AAG(3) | RGA2 protein | 440–480 | 3 | 0.71 |
| AGLC78 | CAA(5) | Translation initiation factor eIF3 – like protein | 430–450 | 2 | 0.44 |
| AGLC79 | No significant homology | 330–410 | 5 | 0.03 | |
| AGLC82 | Unknown protein; protein id: At1g80280.1 | 300–320 | 3 | 0.50 | |
| AGLC83 | Putative valyl tRNA synthetase [ | >1000 | 3 | 0.74 | |
| AGLC84 | AAG(3) | DEAD/DEAH box RNA helicase | 430–450 | 3 | 0.42 |
| AGLC85 | Emb trypsin inhibitor cme precursor | 410–450 | 3 | 0.47 | |
| AGLC88 | Chromomethylase CMT2 | >1000 | 5 | 0.78 | |
| AGLC93 | BZIP family transcription factor | >1000 | 2 | 0.51 | |
| AGLC94 | T48 ankyrin-like protein | 480–500 | 4 | 0.67 | |
| AGLC96 | Hypothetical protein CAB95829.1 | 310–360 | 5 | 0.59 | |
| AGLC98 | AG(19) | Hypothetical protein | 405–450 | 5 | 0.78 |
| AGLC101 | No Significant homology | 370–400 | 4 | 0.70 |
Figure 3Principle Coordinate Analysis (PCoA) plot from diversity analysis of 44 EST markers screened across 14 accessions representing 8 wild Cicer species and one cultivated genotype (ICC4958).
Figure 4Dendogram of 14 Cicer accessions (representing 8 wild species and one cultivated genotype, ICC4958) based on parsimony analysis of 103 EST alleles.
Passport data of Cicer accessions used in this study.
| ICC4958 | JGC 1 | Cultivar | India | no data | no data | |
| IG69947 | Wild | Turkey (Diyarbakir) | 40.0 | 33.1 | ||
| ICC17122 | ICCW 7 | Wild | Turkey (Savur) | 37.5 | 40.9 | |
| IG70029 | Wild | Afghanistan (Bamian) | 67.5 | 34.5 | ||
| ICC17141 | ICCW 26 | Wild | Afghanistan (Shahidan) | 34.2 | 69.7 | |
| IG69976 | Wild | Ethiopia (Tigray) | 38.5 | 14.1 | ||
| IG69974 | Wild | Turkey (Sanli Urfa) | 30.4 | 37.4 | ||
| IG69986 | Wild | Syria (Tartous) | 35.5 | 35.0 | ||
| ICC17148 | ICCW 33 | Wild | Lebanon | no data | no data | |
| IG69961 | Wild | Turkey (Elazig) | 39.2 | 38.4 | ||
| ICC17126 | ICCW 11 | Wild | Turkey | 38.7 | 39.3 | |
| IG69960 | Wild | Turkey (Mardin) | 40.6 | 37.3 | ||
| ICC17121 | ICCW 6 | Wild | Turkey (Savur) | 37.5 | 40.9 | |
| IG69992 | Wild | Afghanistan (Kabul) | 69.4 | 34.4 | ||
| ICC17116 | ICCW 1 | Wild | Afghanistan (Shezghan) | 34.7 | 69.7 |
Permutations of PCR component concentrations used for optimization of PCR conditions for each marker.
| 1 | 0.2 | 5 | 1 | 0.1 | 0.2 |
| 2 | 0.2 | 15 | 2 | 1.5 | 0.5 |
| 3 | 0.3 | 5 | 1.5 | 0.2 | 0.5 |
| 4 | 0.3 | 10 | 2 | 0.1 | 0.3 |
| 5 | 0.5 | 10 | 1 | 0.2 | 0.3 |
PCR amplification profiles used for optimization of PCR conditions for each marker.
| 65-60 | Denaturation | 95 | 3.00 | 1 |
| Touch down | 94 | 0.20 | 5 | |
| 65-60 | 0.20 | |||
| 72 | 0.30 | |||
| Normal | 94 | 0.20 | 30 | |
| 59 | 0.20 | |||
| 72 | 0.30 | |||
| Extension | 72 | 20.0 | 1 | |
| 60-55 | Denaturation | 95 | 3.00 | 1 |
| Touch down | 94 | 0.20 | 5 | |
| 60-55 | 0.20 | |||
| 72 | 0.30 | |||
| Normal | 94 | 0.20 | 30 | |
| 56 | 0.20 | |||
| 72 | 0.30 | |||
| Extension | 72 | 20.0 | 1 | |
| 55-45 | Denaturation | 95 | 3.00 | 1 |
| Touch down | 94 | 0.20 | 10 | |
| 55-45 | 0.20 | |||
| 72 | 0.30 | |||
| Normal | 94 | 0.20 | 30 | |
| 48 | 0.20 | |||
| 72 | 0.30 | |||
| Extension | 72 | 20.0 | 1 |