| Literature DB >> 15890123 |
Steven Van Borm1, Isabelle Thomas, Germaine Hanquet, Bénédicte Lambrecht, Marc Boschmans, Gérald Dupont, Mireille Decaestecker, René Snacken, Thierry van den Berg.
Abstract
We report the isolation and characterization of a highly pathogenic avian influenza A/H5N1 virus from Crested Hawk-Eagles smuggled into Europe by air travel. A screening performed in human and avian contacts indicated no dissemination occurred. Illegal movements of birds are a major threat for the introduction of highly pathogenic avian influenza.Entities:
Mesh:
Substances:
Year: 2005 PMID: 15890123 PMCID: PMC3320388 DOI: 10.3201/eid1105.050211
Source DB: PubMed Journal: Emerg Infect Dis ISSN: 1080-6040 Impact factor: 6.883
Figure 1Crested Hawk-Eagles confiscated at Brussels International Airport in the hand luggage of a Thai passenger. The birds were wrapped in a cotton cloth, with the heads free, and each of them inserted in a wicker tube ≈60 cm in length, with 1 end open. Pictures courtesy of Paul Meuleneire, custom investigations officer, antidrug group.
Primers used for human (h) and avian (a) diagnosis, subtyping, and sequencing
| Primer | Specificity | Host | Primer sequence (5´–3´) | PCR product (bp) | Reference* |
|---|---|---|---|---|---|
| NP1200F | Flu A | h, a | CAGRTACTGGGCHATAAGRAC | 330 | ( |
| NP1529R | Flu A | h, a | GCATTGTCTCCGAAGAAATAAG | ( | |
| NP 1222 F | Flu A | h | CAGRAGYGGAGGRAAYACYAAYC | 245 | This study (IT) |
| NP 1467 R | Flu A | h | CGGGYTCGYTGCCTTYTCGTC | This study (IT) | |
| BHAA | Flu B | h | GTGACTGGTGTGATACCACT | 900 | ( |
| BHAD2 | Flu B | h | TGTTTTCACCATATTGGGGC | ( | |
| BHAB | Flu B | h | CATTTTGCAAATCTCAAAGG | 767 | ( |
| BHAC2 | Flu B | h | TGGAGGCAATCTGCTTCACC | ( | |
| H5-155F | Flu A/H5 | h, a | ACACATGCYCARGACATACT | 545 | ( |
| H5-699R | Flu A/H5 | h, a | CTYTGRTTYAGTGTTGATGT | ( | |
| H5 1 F | Flu A/H5 | h | GCCATTCCACAACATACACCC | 401 | Mod. from ( |
| H5 2 R | Flu A/H5 | h | TTAATTCTCTATCCTCCTTTCCAA | Mod. from ( | |
| H5 IS 1F | Flu A/H5 | h | CTTGCGACTGGGCTCAGAAAT | 645 | This study (IT) |
| H5 IS 2R | Flu A/H5 | h | CCTTCCAACGGCCTCAAACTG | This study (IT) | |
| β act 5 | βactine | h | AACACCCCAGCCATGTAC | 181 | This study (IT) |
| β act 6 | βactine | h | GTAGTCAGTCAGGTCCCG | This study (IT) | |
| β act 7 | βactine | h | AACACCCCAGCCATGTAC | 144 | This study (IT) |
| β act 8 | βactine | h | GCCAGCCAGGTCCAGACG | This study (IT) | |
| 18S-F908 | 18S | a | AGCGAAAGCATTTGCCAAGA | 401 | This study (SVB) |
| 18S-R1309 | 18S | a | AGTCTCGTTCGTTATCGGAATT | This study (SVB) | |
| H5-614F | HA sequencing | a | GARGAYCTTYTRRTAHTRTGG | 645 | This study (MB) |
| H5-1259R | HA sequencing | a | CYTCRAAHTGRGTGTTCATT | This study (MB) |
*IT, Isabelle Thomas; SVB, Steven Van Borm; MB, Marc Boschmans; Mod., modeled.
Figure 2Neighbor-joining phylogenetic tree (rooted to A/turkey/England/50-92/1991) based on the alignment of a 654-bp fragment of the hemagglutinin gene of A/crested eagle/Belgium/2004 (), including the cleaving site. Bootstrap values >50 (1,000 replicates) are indicated near the branches. The Z cluster refers to Li et al. ().