Literature DB >> 15743474

Repression of anti-proliferative factor Tob1 in osteoarthritic cartilage.

Mathias Gebauer1, Joachim Saas, Jochen Haag, Uwe Dietz, Masaharu Takigawa, Eckart Bartnik, Thomas Aigner.   

Abstract

Osteoarthritis is the most common degenerative disorder of the modern world. However, many basic cellular features and molecular processes of the disease are poorly understood. In the present study we used oligonucleotide-based microarray analysis of genes of known or assumed relevance to the cellular phenotype to screen for relevant differences in gene expression between normal and osteoarthritic chondrocytes. Custom made oligonucleotide DNA arrays were used to screen for differentially expressed genes in normal (n = 9) and osteoarthritic (n = 10) cartilage samples. Real-time polymerase chain reaction (PCR) with gene-specific primers was used for quantification. Primary human adult articular chondrocytes and chondrosarcoma cell line HCS-2/8 were used to study changes in gene expression levels after stimulation with interleukin-1beta and bone morphogenetic protein, as well as the dependence on cell differentiation. In situ hybridization with a gene-specific probe was applied to detect mRNA expression levels in fetal growth plate cartilage. Overall, more than 200 significantly regulated genes were detected between normal and osteoarthritic cartilage (P < 0.01). One of the significantly repressed genes, Tob1, encodes a protein belonging to a family involved in silencing cells in terms of proliferation and functional activity. The repression of Tob1 was confirmed by quantitative PCR and correlated to markers of chondrocyte activity and proliferation in vivo. Tob1 expression was also detected at a decreased level in isolated chondrocytes and in the chondrosarcoma cell line HCS-2/8. Again, in these cells it was negatively correlated with proliferative activity and positively with cellular differentiation. Altogether, the downregulation of the expression of Tob1 in osteoarthritic chondrocytes might be an important aspect of the cellular processes taking place during osteoarthritic cartilage degeneration. Activation, the reinitiation of proliferative activity and the loss of a stable phenotype are three major changes in osteoarthritic chondrocytes that are highly significantly correlated with the repression of Tob1 expression.

Entities:  

Mesh:

Substances:

Year:  2005        PMID: 15743474      PMCID: PMC1065318          DOI: 10.1186/ar1479

Source DB:  PubMed          Journal:  Arthritis Res Ther        ISSN: 1478-6354            Impact factor:   5.156


Introduction

Osteoarthritis is the most common disabling condition of humans in the western world. Although osteoarthritis is mainly a disease and functional loss of the articular cartilage covering the joint surfaces, it is clearly the cells that are the active players during the disease process [1]. Whatever pleomorphisms the cellular reaction patterns display at first sight during the osteoarthritic disease process, they can be basically summarized in three categories (reviewed in [2]). First, the chondrocytes can degenerate or proliferate. Second, chondrocytes can activate or deactivate their synthetic anabolic or catabolic matrix-degrading activity by increasing or decreasing anabolic or catabolic gene expression. Last, chondrocytes can undergo phenotypic modulations implicating an overall severely altered gene expression profile of the cells in the diseased tissue. In fact, several distinct phenotypes of chondrocytes are known to occur in vitro, in vivo during fetal development and potentially also in the disease process itself, but new markers are required for the more accurate characterization of cellular behavior [3]. This will allow further analysis of the underlying pathology to develop therapeutic approaches that could delay, stop, or even reverse cartilage degeneration. In many laboratories single and multiple gene analyses have been performed on normal and osteoarthritic cartilage specimens; however, a global overview of disease-associated changes is not available. This highlights the need for establishing a broader gene expression profile of osteoarthritic chondrocytes by modern screening technologies so as to characterize more properly the cellular events and regulatory pathways directly involved in cartilage destruction. In the present study, we designed a custom-made oligonucleotide-based microarray to screen for differentially expressed genes in normal and osteoarthritic cartilage specimens. We found that Tob1, a gene involved in cell cycle regulation and cell quiescence [4,5], was significantly repressed in osteoarthritic chondrocytes. This was confirmed by quantitative polymerase chain reaction (qPCR) and further analyzed in adult articular chondrocytes in vitro and in vivo.

Materials and methods

Donors for mRNA expression analysis

For the study of mRNA expression levels within the tissue, cartilage from human femoral condyles of normal knee joints was used. Normal articular cartilage (nqPCR = 10, age range 45–88 years, mean age 64.1 years; narray = 9, age range 37–83 years, mean age 59 years) was obtained from donors at autopsy, within 48 hours of death. Osteoarthritic cartilage samples from late-stage osteoarthritic joint disease were obtained from patients undergoing total knee replacement surgery (nqPCR= 15, age range 63–85 years, mean age 74.5 years; narray = 10, age range 57 to 84 years, mean age 76 years). The cartilage was frozen in liquid nitrogen immediately after removal and stored at -80°C until required for RNA isolation. Cartilage was considered to be normal according to a macroscopic scoring system of the opened joint: this mainly included normal synovial membrane, normal synovial fluid, no significant overall softening or surface fibrillation (except on the tibial plateau, which is basically found in all specimens depending on age). The Mankin's grade of histological plugs taken was less than 3. Osteoarthritic cases fulfilled the criteria published by the American College of Rheumatology [6]. Cases of rheumatoid origin were excluded from the study.

Isolation of primary human articular chondrocytes; stimulation with interleukin (IL)-1β and bone morphogenetic protein (BMP)-7

Normal human knee articular cartilage was obtained from six normal cases at autopsy within 48 hours of death. Cartilage pieces were finely chopped and chondrocytes were isolated enzymatically as described previously [7]. Chondrocytes were either plated in high-density monolayer cultures or cultured in alginate beads. Cultures were maintained for 48 hours in serum-free Dulbecco's modified Eagle's medium/F12 medium (Gibco BRL, Eggstein, Germany) supplemented with 1% penicillin/streptomycin solution (Gibco BRL) and 50 μg/ml ascorbate (Sigma, Taufkirchen, Germany) and 10% fetal calf serum (Biochrom, Berlin, Germany). After 48 hours, primary (non-passaged) chondrocytes were stimulated with 1 ng/ml IL-1β (R&D System, Minneapolis, MN, USA) in DMEM/F12 medium, 100 ng/ml recombinant human BMP-7 (Stryker Biotech, Hopkinton, MA, USA) or cultivated in medium alone for 24 hours with no medium change afterwards. The same experiments were performed in parallel in the presence and in the absence of 10% fetal calf serum. At the end of the culturing/stimulation period the cells were washed in sterile phosphate-buffered saline (PBS), lysed in 350 μl of lysate RLT buffer/106 cells and stored at -80°C.

Culture of HCS-2/8 cells

The human HCS-2/8 chondrosarcoma cell line (around passage 50–55) [8,9] was cultured in DMEM (PAA, Linz, Austria) supplemented with 20% fetal bovine serum (Gibco BRL) and with 50 μg/ml ascorbate (Sigma) in a humidified atmosphere of 5% CO2 at 37°C as described [9]. Cells were seeded at 105 cells/cm2 and grown for 3 days to obtain subconfluent stage cultures, at 2 × 105/cm2 and cultured for 7 days to obtain confluent stage cultures, and at 6 × 105/cm2 and grown for 10 days for over-confluent stage cultures.

RNA isolation from articular cartilage and isolated articular chondrocytes

Total RNA from both cartilage tissue and isolated chondrocytes was isolated as described previously [10,11]. The quality of total RNA samples was checked by agarose-gel electrophoresis and with the Bioanalyzer RNA 6000 Nano assay (Agilent, Waldbronn, Germany).

Construction of the SensiChip cartilage microarray

The SensiChip technology is a two-color microarray platform using the Planar Wave Guide technology for microarray detection [12], which increases signal-to-noise ratios and thereby the sensitivity of hybridization experiments. The arrays were spotted in duplicate with 70-mer oligonucleotides representing the 3' untranslated region (UTR) of about 340 human cartilage-relevant genes, whereas one single gene was represented by one 70-mer oligonucleotide.

Expression profiling with the SensiChip two-color DNA-microarray platform

Total RNA (250 ng) from osteoarthritic cartilage (10 samples) and pooled normal cartilage was amplified and labeled with Cy3-UTP and Cy5-UTP respectively (Amersham Pharmacia) using the MessageAmp aRNA kit (Ambion). After clean-up of the complementary RNA (cRNA) with the RNeasy kit (Qiagen), 5 μg of Cy3-labeled cRNA from osteoarthritic cartilage was mixed with 5 μg of Cy5-labeled cRNA from pooled normal cartilage. cRNA was fragmented by incubation with 40 mM Tris-acetate, pH 8.1, 100 mM potassium acetate, 30 mM magnesium acetate for 15 min at 95°C and desalted with a Microcon YM-10 concentrator (Millipore). Mixed Cy-dye labeled cRNA samples (600 ng) were hybridized for 16 hours on a SensiChip microarray (Qiagen) spotted in duplicate with 70-mer oligonucleotides representing the 3' UTR of selected genes. The gene-specific oligonucleotide sequences were designed by Operon by using GenBank accession numbers and proprietary algorithms. After washing steps performed in accordance with the manufacturer's standard protocol, arrays were scanned with the SensiChip Reader. The resulting array images were analyzed with SensiChip View 2.1 software (Qiagen) to quantify gene-specific signal intensities. For quality control of RNA labeling and hybridization efficiency, oligonucleotides representing human housekeeping genes, negative and external bacterial spiking controls were also included. These sequences were prelabeled with fluorescent Cy3 and Cy5 dyes, and mixed in different concentrations into the hybridization solutions containing the labeled cRNA samples from human cartilage.

Expression data analysis

All microarray scans were inspected visually and checked for quality on the basis of the performance of negative, housekeeping and externally added Cy3/Cy5-prelabeled spiking controls. Raw signal intensities from each scan were imported into the gene expression analysis software Resolver version 4.0 (Rosetta Biosoftware, Seattle, WA, USA). The software employs an error-modeling approach for the analysis of microarray data [13]. An error model specific for the SensiChip microarray platform was designed by Rosetta Biosoftware based on expression data from repeated hybridizations of the same RNA material to determine the variation of signal intensities. A complete description of the statistical methods used is available in the technology section of the Rosetta Biosoftware website . All scans were pre-processed and normalized with the SensiChip error model to calculate P values and error bars for every gene expression profile. The P value represented the probability that an observed gene regulation was due to a measurement error. Gene regulation was considered as statistically significant if the calculated P value was below a threshold of 0.05. For normalization of expression data, the average brightness of the Cy3 and Cy5 channels respectively was used that was calculated from spots within a range from 30% to 85% of the signal intensity distribution of all spots. Scans from multiple experiments (replicates) were combined by averaging expression data with an error-weighted algorithm (also described in the statistical methods document available on the Rosetta Biosoftware website).

Real-time quantitative PCR using TaqMan technology

Real-time PCR was used to detect human Tob1, collagen type II, Ki-67, matrix metalloproteinase (MMP)-13 and glyceraldehyde-3-phosphate dehydrogenase mRNA expression levels in human articular cartilage RNA samples. The primers (MWG Biotech, Ebersberg, Germany) and TaqMan probes (Eurogentec, Liège, Belgium) were designed using Primer Express™ software (Perkin Elmer). To be able to obtain quantifiable results for all genes, specific standard curves using sequence-specific control probes were performed in parallel to the analyses. Thus, for each gene a gene-specific cDNA fragment was amplified by the gene-specific primers (Table 1) and cloned into pGEM T Easy (Promega, Mannheim, Germany) or pCRII TOPO (Invitrogen, Karlsruhe, Germany). The cloned amplification product was sequenced to confirm correct cloning. Cloned standard probes were amplified with the plasmid amplification kit (Qiagen), linearized and used after careful estimation of the concentration (gel electrophoresis, photometry, and a fluorimetric assay for deoxyribonucleic acids (Picogreen; Molecular Probes, Eugene, OR, USA)). For the standard curves concentrations of 10, 100, 1000, 10,000, 100,000, and 1,000,000 molecules per assay were used (all in triplicate).
Table 1

Sequences of primers and probes for quantitative real-time polymerase chain reaction

GeneGenBank accession no.Primers (5'→3')Conc. (nM)Probe (5'→3')MgCl2 (mM)
GAPDHNM_002046Forward: GAAGGTGAAGGTCGGAGTC50CAAGCTTCCCGTTCTCAGCC5.5
Reverse: GAAGATGGTGATGGGATTTC900
TOB1NM_005749Forward: TCTGCTGCTGTAAGCCCTACCT300CGGTCCACTCAGCCTTTAACCTTTACCACT6.5
Reverse: TTCATTTTGGTAGAGCCGAACTT900
Ki-67NM_002417Forward: CAGTGATCAACGCCGTAGGTC900CTTCCAGCAGCAAATCTCAGACAGAGGTTC6.0
Reverse: TCGGCTGATAGACACTCTCTTTTG900
COL2A1NM_001844Forward:CAACACTGCCAACGTCCAGAT50ACCTTCCTACGCCTGCTGTCCACG5.5
Reverse: CTGCTTCGTCCAGATAGGCAAT300
MMP-13NM_002427Forward: TCCTCTTCTTGAGCTGGACTCATT900TCCTCAGACAAATCATCTTCATCACCACCAC7.0
Reverse: CGCTCTGCAAACTGGAGGTC50

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMP, matrix metalloproteinase; COL2A1, collagen type II (alpha 1 chain); TOB1, Transducer of ERBB2.

For the analyses of the different genes, a separate master mixture was made up for each of the primer pairs and contained a final concentration of 200 μM NTPs, 600 nM Roxbuffer and 100 nM TaqMan probe. For all genes the final reaction mixture contained, besides cDNA and 1 U polymerase (Eurogentec), forward and reverse primers, the corresponding probes, and MgCl2 at concentrations given in Table 1. All experiments were performed in triplicate.

Immunofluorescence

Immunofluorescence studies were performed on paraformaldehyde-fixed paraffin-embedded specimens of normal (n = 5) and osteoarthritic (n = 5) articular cartilage. Sections were first incubated with the primary antibodies overnight, then with biotin-labeled goat anti-mouse antibodies (Dianova, Hamburg, Germany) and then with peroxidase-labeled streptavidin (Dianova). Subsequently, the tyramide amplification system (PerkinElmer, Boston, MA, USA) was used for signal amplification. Finally, the signals were detected with Cy5-labeled streptavidin (Dianova). Nuclear staining was again performed with 4,6-diamidino-2-phenylindole. The sections were evaluated by a (fluorescence) microscope (Olympus AX70) and photographed digitally. To obtain optimal staining results various enzymatic pretreatments were tested, including hyaluronidase (Boehringer, Mannheim, Germany; 2 mg/ml in PBS pH 5 for 60 min at 37°C), pronase (Sigma, Deisenhofen, Germany; 2 mg/ml in PBS pH 7.3 for 60 min at 37°C), and bacterial protease XXIV (Sigma; 0.02 mg/ml; PBS pH 7.3 for 60 min at 37°C). Finally, the mouse monoclonal antibodies against Tob1 (Assay Designs, Ann Arbor, MI, USA) were used at a dilution of 1:20 without pretreatment of the sections.

Amplification and cloning of Tob1 cDNA

RNA was isolated from differentiated ADTC5 cells (Ricken Library) in accordance with the extraction method with Trizol® (Invitrogen) and reverse-transcribed into cDNA with SuperScript II™ reverse transcriptase (Invitrogen) by following the manufacturer's recommendation. PCR amplification of a 607 base pair Tob1 cDNA fragment (nucleotides 402–1008 of the sequence in GenBank accession no. NM_009427) was performed with gene-specific primers (forward, 5'-GGAGCCCCCAGGTGTTCATGC-3'; reverse, 5'-CTCGTTGAGGCCTCCGTAGG-3') by a standard method, and amplification products were cloned into pCR®-BluntII-TOPO® vector (Invitrogen).

In situ hybridization

In situ hybridization of sectioned appendicular skeleton from newborn mice was performed with digoxigenin-labeled antisense riboprobes transcribed from the Tob1 cDNA fragment. Hindlegs of newborn mice were fixed overnight in 4% paraformaldehyde resolved in PBS. After stepwise transfer through solutions with increasing ethanol concentration, the specimens were incubated in xylene and finally embedded in paraffin wax. For in situ hybridization, paraffin-embedded samples were cut into slices 7 μm thick and mounted on microscope slides. The sections were hybridized with digoxigenin-11-UTP-labeled antisense riboprobes, which were transcribed with T7 RNA polymerase from the Tob1 cDNA fragment cloned into pCR®-BluntII-TOPO® (Invitrogen), after linearization of the plasmid with BamHI. In situ hybridization was performed as described by Dietz and colleagues [14]. After detection of hybridization products, the sections were mounted under coverslips in Kaiser's glycerol gelatin (Merck) and photographed under a Zeiss Axioplan 2 microscope.

Results

A microarray covering 340 human cartilage relevant genes was constructed, where one single gene was represented by one 70-mer oligonucleotide (Fig. 1a). Most genes were selected from the literature and have important roles in anabolic or catabolic pathways during osteoarthritis (for example, cartilage matrix proteins such as collagens, relevant degrading enzymes such as MMPs and aggrecanases, and genes from important catabolic [IL-1, tumor necrosis factor-α] and anabolic [BMP, transforming growth factor-β] signaling pathways).
Figure 1

Tob1 expression in normal and osteoarthritic cartilage (oligonucleotide array experiments). (a) Area of one customized SensiChip microarray illustrating the 70-mer oligonucleotide spots that represent the 3'-untranslated region of human Tob1 and demonstrate its differential expression between normal and one late-stage osteoarthritic cartilage. (b) Trend plot demonstrating the transcriptional downregulation of human Tob1 in all RNA samples from cartilage of late-stage osteoarthritis patients used for SensiChip hybridization experiments. The logarithmic ratio of differential Tob1 expression calculated by the software Resolver is plotted against the corresponding osteoarthritic patient sample used for expression profiling. Error bars indicate standard deviations of ratios. P values for the ratios of all 10 osteoarthritic samples were less than 0.05. (c) Transcriptional downregulation of human Tob1 in late-stage osteoarthritic cartilage samples from 10 human donors. All Tob1 ratios were calculated by the gene expression analysis software Resolver. P values for the ratios of all 10 osteoarthritic samples were less than 0.05. (d) Plot of average Tob1 signal intensities from independent SensiChip microarray hybridizations using RNA samples from normal cartilage, late-stage osteoarthritic cartilage and cultured primary human chondrocytes. Tob1 signal intensities from independent SensiChip hybridizations of RNA samples from pooled normal cartilage (10 hybridization experiments), 10 late-stage osteoarthritis patients (10 hybridization experiments) and 5 different cell culture samples of proliferating primary human chondrocytes (5 hybridization experiments) were merged respectively and are plotted as average Tob1 signal intensities. Error bars indicate standard deviations of Tob1 signal intensities.

Gene expression analysis: differentially expressed genes

Total RNAs from 10 late-stage osteoarthritic cartilage samples were hybridized separately against a pool of mixed total RNAs from nine normal cartilage donors on the customized SensiChip microarrays. Merging of expression profiles obtained from all 10 late-stage osteoarthritic cartilage samples used for hybridizations resulted in about 200 significantly regulated genes that were differentially expressed between normal and osteoarthritic cartilage, with P < 0.01 (Fig. 2 and Table 2; the whole data set is in Additional file 1).
Figure 2

Plot of normalized logarithmic expression signal intensities RNAs from late osteoarthritic against the intensities for normal cartilage. RNA samples from 10 late-stage osteoarthritis patients were hybridized in comparison with normal cartilage (pool of nine donors) on SensiChip microarrays. After normalization, expression data were merged and corresponding signal intensities of late-stage osteoarthritis patients and normal cartilage were plotted against each other. Several differentially expressed marker genes (P < 0.01) are highlighted and diagonal lines indicate a twofold regulation. Error bars show standard deviations of ratios.

Table 2

Table showing genes which were upregulated or downregulated in osteoarthritic chondrocytes (changes in mRNA expression levels >2-fold; P < 0.01)

Downregulated genesGenBank accession no.OA:NOANUpregulated genesGenBank accession no.OA:NOAN
CHI3L1NM_0012760.020.0010.05COMPNM_0000952.0719.9310.68
FollistatinNM_0063500.060.010.22BGLAPX536982.180.130.07
APODNM_0016470.081.1015.68TIMP1X031242.2012.186.34
EDR2NM_0044270.090.090.86ARGBP2AF0498842.250.110.04
MMP3X052320.091.0410.28FGF18AF0752922.350.400.16
Tob1NM_0057490.140.120.96FibronectinM109052.3619.089.46
SLC3A2NM_0023940.190.040.22Frizzled homolog 1NM_0035052.370.050.03
MAPK7NM_0027490.220.010.05Choriolysin h 2AA8296852.380.060.03
SOX9Z466290.260.291.14CRTL1NM_0018842.430.760.31
SERPING1NM_0000620.270.763.27MKP-LNM_0070262.570.320.11
TGFBR3NM_0032430.270.050.15THBS3NM_0071122.590.110.04
FRZBNM_0014630.270.231.43ADAMTS2NM_0142442.680.060.02
MRS3/4AF3274020.280.120.43ADAMTS1NM_0069882.700.120.05
UBCM268800.313.2911.04CHM-INM_0070152.880.360.09
Integrin α5NM_0022050.350.361.17MMP-13X753082.880.130.06
GNB2L1NM_0060980.381.152.39COL6A1X158802.899.552.94
NF-κB_p65Q042060.400.040.10COL11A1J041773.840.520.16
Pim-1Z585950.410.050.15TNFAIP6NM_0071154.730.330.07
NCK1NM_0061530.410.010.04Thrombospondin 2NM_0032475.010.130.03
GSSNM_0001780.430.030.06COL2A1X164685.6711.622.20
HLA-BM817980.431.433.50SPP1NM_0005825.781.960.38
ICAM1NM_0002010.440.090.26CKTSF1B1NM_0133725.890.060.01
TG-interacting factorNM_0032440.470.050.10COL6A3NM_0043698.703.490.45
Phosphomannomutase 1U860700.470.110.26COL1A2X5552514.254.210.33
DLX5NM_0052210.470.040.08TGFBINM_00035814.672.410.18
BiglycanNM_0017110.490.210.50COL3A1X1442031.3315.330.52
TP53NM_0005460.500.140.34

N, mean of mRNA expression levels in the normal cartilage samples (in arbitrary units); OA, mean of mRNA expression levels in the osteoarthritic cartilage samples (in arbitrary units); OA:N, ratio of osteoarthritic to normal.

Tob1 is repressed in osteoarthritic chondrocytes

One of the differentially expressed genes was the human transducer of ERBB2,1 (Tob1; GenBank accession no. NM_005749). Tob1 was transcriptionally downregulated in all 10 human osteoarthritic cartilage samples to, on average, one-sixth (Fig. 1). Corresponding P values were less than 0.05 for all human OA samples.

Confirmation of Tob1 expression and regulation by (quantitative) PCR and immunostaining in normal and osteoarthritic articular cartilage

Conventional PCR confirmed the expression of Tob1, both in normal (n = 3) and osteoarthritic (n = 3) chondrocytes, with a weaker signal detected in the osteoarthritic samples (Fig. 3a). To validate and quantify differential regulation of Tob1, qPCR was performed on a set of normal (n = 10) and osteoarthritic (n = 15) samples. These experiments confirmed both its expression in normal articular cartilage and a highly significant decrease in Tob1 transcript levels in osteoarthritic samples (7.8-fold; P < 0.001; Fig. 3b).
Figure 3

Tob1 expression in fetal, normal and osteoarthritic cartilage (PCR, immunostaining, in situ hybridization). (a) Conventional PCR demonstrates the expression of Tob1 in normal and (at a reduced level) in osteoarthritic cartilage samples (lanes 1 and 9, molecular weight standards; lanes 2–4, normal cartilages; lanes 5–7, osteoarthritic cartilages; lane 8, negative control). In all experiments the RNA was directly from the tissue (without isolation of cells before isolation of RNA). (b) Quantitative real-time PCR analysis for mRNA expression levels of Tob1 in normal (n = 10) and peripheral (pOA, n = 8) and central (cOA, n = 7) osteoarthritic cartilage as well as normal adult articular chondrocytes cultured with (n = 6) and without (n = 3) serum. Results are shown as ratios to glyceraldehyde-3-phosphate dehydrogenase. (c, d) Immunolocalization of Tob1 in human normal (c) and osteoarthritic (d) articular cartilage (in both the middle and upper deep zones of the cartilage are shown). (e) mRNA expression analysis of Tob1 in fetal growth plate cartilage of mice, with the use of in situ hybridization: detectable expression levels are restricted to the hypertrophic zone (and osteoblasts).

Immunolocalization with monoclonal antibodies against Tob1 showed the presence of Tob1 protein in normal (n = 5) and osteoarthritic (n = 8) articular chondrocytes (Fig. 3c,d). A somewhat weaker staining was observed in the osteoarthritic specimens than in the normal specimens, but this was not quantifiable because of the immunostaining technology used.

Correlation of Tob1 expression to markers for chondrocyte anabolism, catabolism, and proliferation

Next we examined whether Tob1 gene expression levels were correlated with the expression of marker genes of cell proliferation (Ki-67) and anabolic (collagen type II) and catabolic (MMP-13) activation of articular chondrocytes. This analysis showed highly significant correlations between these genes in osteoarthritic compared with normal chondrocytes (Fig. 4).
Figure 4

Comparative analysis of mRNA expression levels of collagen type II (Col2), Ki-67, and MMP-13 relative to Tob1 in normal and osteoarthritic chondrocytes.

Expression of Tob1 in articular chondrocytes in vitro

Tob1 was expressed in isolated human adult articular chondrocytes in vitro. The mRNA expression levels of Tob1 in vitro were comparable to those of osteoarthritic chondrocytes in situ and were therefore significantly lower than those of normal chondrocytes in situ (oligo-array, Fig. 1d; qPCR, Fig. 3b). It is noteworthy that Tob1 was more strongly expressed in cells cultured without serum than with it. No significant regulation of Tob1 was found by two major anabolic (BMP-7) and catabolic (IL-1β) mediators in adult articular cartilage in cultured chondrocytes in vitro (data not shown).

Expression of Tob1 in the fetal growth plate and during chondrocyte differentiation in vitro

In situ hybridization on mouse fetal growth plate cartilage was performed to assess differential expression in the different cartilage zones. This showed that the expression of Tob1 was concentrated in the hypertrophic zone (zone of terminal differentiation and cessation of proliferation). Cells of the resting and proliferating zones (that is, areas of proliferation and matrix synthesis) showed no or very much weaker staining (Fig. 3e). In addition, osteoblasts were positive (not shown). Expression profiling in HCS-2/8 cells, which are known to show a more differentiated phenotype in high-density cultures than when cultured in subconfluent or confluent status [15] showed an inverse relationship between Tob1 expression and the proliferation marker Ki-67 (Fig. 5).
Figure 5

Comparative mRNA analysis for Tob1 and proliferation associated Ki-67 mRNA expression in chondrocytic HCS-2/8 cells. HCS-2/8 cells were cultured in sub-confluent, confluent, and over-confluent conditions and the Tob1 mRNA levels determined by qPCR (shown are the ratios to glyceraldehyde-3-phosphate dehydrogenase (GADPH)).

Discussion

Differential gene expression analysis, as performed by us on normal and osteoarthritic chondrocytes, reveals long lists of differentially expressed genes of potential interest for furthering the understanding, diagnosis and/or modulation of osteoarthritis. The genes identified might be interesting with regard to any of these three aspects, but careful validation is needed to confirm the relevance of the findings obtained. In this regard, three levels of validation have to be achieved: (1) technical validation of screening results, (2) functional validation of the gene in situ or in vitro, and finally (3) establishment of relevance of the gene for the (physiology and/or) pathophysiology of the tissue. In our oligonucleotide-based array screen we detected many known differentially expressed genes. Thus, many marker genes behaved as expected from previous investigations: stromelysin I (MMP-3) [7] and the cartilage transcription factor SOX9 [16] were significantly downregulated, whereas many constituents of the extracellular matrix were significantly upregulated (collagen types II [17], III [18], VI [19], COMP [20], and fibronectin [21]). Further, MMP-13, the major collagenase of osteoarthritic cartilage [22,23], was induced [7]). Taken together, these findings validated this gene array technology as a reliable tool for identifying differentially expressed genes. In addition, many genes previously unknown to be differentially regulated in osteoarthritic cartilage were detected. Among the new differentially expressed genes we identified Tob1 as being significantly downregulated in osteoarthritic compared with normal articular chondrocytes. For technical validation (validation level I), this was confirmed by conventional and quantitative PCR at a very high significance level. Immunostaining provided additional evidence of the presence of Tob1 in normal and osteoarthritic chondrocytes. Tob1, originally identified as binding partner of Erb ('transducer of Erb' [24]), is a member of a larger family of proteins, which share common protein domains and are known to exert anti-proliferative and phenotype-stabilizing effects on various cell types including osteoblasts ([24,25]; reviewed in [4] and [5]). Thus, to obtain insights into the functional activity of Tob1 in articular cartilage (validation level II), we correlated Tob1 expression with the expression of the Ki-67 antigen, a well-established gene expressed only by cells in the proliferation phase [26]. We found a highly significant inverse correlation between Tob1 expression and proliferative activity of chondrocytes. It is noteworthy that after isolation from the articular matrix Tob1 was also repressed in normal articular chondrocytes in vitro. This might well reflect the fact that adult articular chondrocytes show an increased proliferative activity and also enhanced anabolic [27] and catabolic activity [7] after removal from the tissue. The fact that cells cultured with serum in vitro showed even lower Tob1 expression levels than cultures without serum further supports this notion, because serum is known to increase proliferation of chondrocytes in vitro [28]. In addition, the chondrocytic cell line HCS-2/8 showed an inverse relationship between proliferative activity and cell differentiation on the one hand and Tob1 expression on the other. Interestingly, fetal chondrocytes in situ selectively express Tob1 in the hypertrophic zone, which is in contrast to other zones where no proliferative activity is seen [25]. This indicates that Tob1 expression in chondrocytes is inversely related to proliferation in a similar way to that seen in T cells [29]. Another basic effect of Tob1 is also observed in chondrocytes: a repression of Tob1 is needed before activation of otherwise quiescent T cells [29,30]; similarly, there is a clearcut inverse correlation between (anabolic and catabolic) chondrocyte activity and Tob1 expression. In many respects the downregulation of Tob1 fits well into the scenarios taking place during osteoarthritis (validation level III), which suggests that Tob1 is a potential key molecule of cell phenotype regulation in osteoarthritic chondrocytes. Thus, in osteoarthritic cartilage an increase in proliferation [31-35] is found, whereas hardly any proliferative activity exists in normal articular adult cartilage [31,32]. These cells seem to be G0-arrested, quiescent and phenotypically stable, in other words exactly the cell type that would be expected to express high levels of Tob1 [4,29]. It is noteworthy that both phenotypic instability [36] and anabolic activation [17] are key features of osteoarthritic chondrocytes, fitting well to the downregulation of Tob1. Tob1 seems in many circumstances and, in particular, in skeletal cells to interact with the BMP pathway [37]. Tob1-knockout mice develop osteopetrosis due to a lack of inhibition of BMP-stimulated bone growth [37]. In addition, overexpression of Tob1 reduces BMP2 signaling [38]. Although in Tob1-knockout mice no specific 'hyperplastic' cartilage phenotype was obvious, BMP-2 and BMP-7 are reported to have important functions in cartilage homeostasis [39,40]. The presence of Tob1 could therefore explain why, despite the presence of BMPs within articular cartilage [39], normal chondrocytes show only very low anabolic activity. By the same argument, osteoarthritic chondrocytes BMPs might have much more anabolic potential, a feature recently suggested in studies in vitro [27]. In sum, our study provides for the first time compelling evidence of the expression and presence of Tob1 as a new intracellular mediator in adult articular chondrocytes and its downregulation in the osteoarthritic disease process. Tob1 fits well functionally with the cellular biological changes found in this condition such as proliferation, activation and the loss of a differentiated phenotype. Our data, together with the knowledge from other cellular systems in the literature, suggest that Tob1 is a key molecule in the scenario of cellular alterations of osteoarthritis.

Conclusions

Oligonucleotide-based microarray analysis was used to screen for differences in gene expression levels in between normal and osteoarthritic chondrocytes. Among other genes, Tob1 was identified as being significantly downregulated in osteoarthritic chondrocytes. Correlative gene expression studies on cellular features such as cell proliferation, cell activation and the loss of a differentiated phenotype suggest that downregulation of Tob1 expression might be an important aspect of cellular processes in osteoarthritic cartilage degeneration.

Abbreviations

BMP = bone morphogenetic protein; cDNA = complementary DNA; cRNA = complementary RNA; IL = interleukin; MMP = matrix metalloproteinase; PBS = phosphate-buffered saline; PCR = polymerase chain reaction; qPCR = quantitative polymerase chain reaction; UTR = untranslated region.

Competing interests

The author(s) declare that they have no competing interests. MG, JS, UD, and EB are all employed by Sanofi-Aventis as research scientists. The publication is a result of a scientific collaboration between industry and the other academic authors. The protein Tob1 is not pursued as a project within the osteoarthritis portfolio of Sanofi-Aventis; therefore the industry-affiliated authors have stated that they and the company have no competing interests.

Authors' contributions

MG performed the gene expression analysis. JS cultured the HCS-2/8 cells and contributed to the bioinformatic analysis of obtained data sets. JH performed the collection and processing of human material (including RNA isolation). UD performed the in situ hybridization analysis. MT contributed the HCS-2/8 cell line. EB participated in the design of the study and coordinated the gene expression experiments including the bioinformatic analysis. TA wrote most of the manuscript and participated in the design of the study. His group contributed the TaqMan, conventional PCR and immunohistochemical analyses (together with JH). All authors contributed to writing and correcting the manuscript and have approved the final version.

Additional File 1

An Excel file that contains details of 200 significantly regulated genes that were differentially expressed between normal and osteoarthritic cartilage with P values <0.01. Click here for file
  39 in total

1.  Spatio-temporal distribution of chondromodulin-I mRNA in the chicken embryo: expression during cartilage development and formation of the heart and eye.

Authors:  U H Dietz; G Ziegelmeier; K Bittner; P Bruckner; R Balling
Journal:  Dev Dyn       Date:  1999-11       Impact factor: 3.780

2.  Cell counts of normal and osteoarthritic articular cartilage in relation to the uptake of sulphate (35SO4) in vitro.

Authors:  G MEACHIM; D H COLLINS
Journal:  Ann Rheum Dis       Date:  1962-03       Impact factor: 19.103

3.  Apoptotic cell death is not a widespread phenomenon in normal aging and osteoarthritis human articular knee cartilage: a study of proliferation, programmed cell death (apoptosis), and viability of chondrocytes in normal and osteoarthritic human knee cartilage.

Authors:  T Aigner; M Hemmel; D Neureiter; P M Gebhard; G Zeiler; T Kirchner; L McKenna
Journal:  Arthritis Rheum       Date:  2001-06

Review 4.  In search of a function for the TIS21/PC3/BTG1/TOB family.

Authors:  S Matsuda; J Rouault; J Magaud; C Berthet
Journal:  FEBS Lett       Date:  2001-05-25       Impact factor: 4.124

5.  Postnatal expression in hyaline cartilage of constitutively active human collagenase-3 (MMP-13) induces osteoarthritis in mice.

Authors:  L A Neuhold; L Killar; W Zhao; M L Sung; L Warner; J Kulik; J Turner; W Wu; C Billinghurst; T Meijers; A R Poole; P Babij; L J DeGennaro
Journal:  J Clin Invest       Date:  2001-01       Impact factor: 14.808

Review 6.  The gene PC3(TIS21/BTG2), prototype member of the PC3/BTG/TOB family: regulator in control of cell growth, differentiation, and DNA repair?

Authors:  F Tirone
Journal:  J Cell Physiol       Date:  2001-05       Impact factor: 6.384

7.  Up-regulation of cartilage oligomeric matrix protein at the onset of articular cartilage degeneration in a transgenic mouse model of osteoarthritis.

Authors:  H Salminen; M Perälä; P Lorenzo; T Saxne; D Heinegård; A M Säämänen; E Vuorio
Journal:  Arthritis Rheum       Date:  2000-08

8.  Effective isolation of high-quality total RNA from human adult articular cartilage.

Authors:  L A McKenna; A Gehrsitz; S Söder; W Eger; T Kirchner; T Aigner
Journal:  Anal Biochem       Date:  2000-11-01       Impact factor: 3.365

9.  Negative regulation of BMP/Smad signaling by Tob in osteoblasts.

Authors:  Y Yoshida; S Tanaka; H Umemori; O Minowa; M Usui; N Ikematsu; E Hosoda; T Imamura; J Kuno; T Yamashita; K Miyazono; M Noda; T Noda; T Yamamoto
Journal:  Cell       Date:  2000-12-22       Impact factor: 41.582

Review 10.  Articular cartilage and changes in arthritis. An introduction: cell biology of osteoarthritis.

Authors:  L J Sandell; T Aigner
Journal:  Arthritis Res       Date:  2001-01-22
View more
  8 in total

Review 1.  A systems biology approach to synovial joint lubrication in health, injury, and disease.

Authors:  Alexander Y Hui; William J McCarty; Koichi Masuda; Gary S Firestein; Robert L Sah
Journal:  Wiley Interdiscip Rev Syst Biol Med       Date:  2011-08-08

2.  Phenotypic characterization of epiphycan-deficient and epiphycan/biglycan double-deficient mice.

Authors:  S Nuka; W Zhou; S P Henry; C M Gendron; J B Schultz; T Shinomura; J Johnson; Y Wang; D R Keene; R Ramírez-Solis; R R Behringer; M F Young; M Höök
Journal:  Osteoarthritis Cartilage       Date:  2009-11-18       Impact factor: 6.576

Review 3.  New thoughts on the pathophysiology of osteoarthritis: one more step toward new therapeutic targets.

Authors:  Johanne Martel-Pelletier; Daniel Lajeunesse; Hassan Fahmi; Ginette Tardif; Jean-Pierre Pelletier
Journal:  Curr Rheumatol Rep       Date:  2006-02       Impact factor: 4.592

4.  Developmental mechanisms in articular cartilage degradation in osteoarthritis.

Authors:  Elena V Tchetina
Journal:  Arthritis       Date:  2010-12-29

5.  Sequential alterations in catabolic and anabolic gene expression parallel pathological changes during progression of monoiodoacetate-induced arthritis.

Authors:  Jin Nam; Priyangi Perera; Jie Liu; Bjoern Rath; James Deschner; Robert Gassner; Timothy A Butterfield; Sudha Agarwal
Journal:  PLoS One       Date:  2011-09-13       Impact factor: 3.240

6.  Expression of bioactive bone morphogenetic proteins in the subacromial bursa of patients with chronic degeneration of the rotator cuff.

Authors:  Jana Neuwirth; Renée A E Fuhrmann; Amanda Veit; Matthias Aurich; Ilmars Stonâns; Tilo Trommer; Peter Hortschansky; Susanna Chubinskaya; Juergen A Mollenhauer
Journal:  Arthritis Res Ther       Date:  2006       Impact factor: 5.156

7.  Peripheral shift in the viable chondrocyte population of the medial femoral condyle after anterior cruciate ligament injury in the porcine knee.

Authors:  Meggin Q Costa; Martha M Murray; Jakob T Sieker; Naga Padmini Karamchedu; Benedikt L Proffen; Braden C Fleming
Journal:  PLoS One       Date:  2021-08-26       Impact factor: 3.240

8.  SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis.

Authors:  Simon R Tew; Peter D Clegg; Christopher J Brew; Colette M Redmond; Timothy E Hardingham
Journal:  Arthritis Res Ther       Date:  2007       Impact factor: 5.156

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.