Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat.

Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study. The LMW-GS gene located at the Glu-D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3-LMWGS1 (AY263369), contains the endosperm-specific-expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3-LMWGS1 with other reported LMW-GS genes located at different Glu-3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW-GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3-LMWGS1 with the sequences of 12 group LMW-GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW-GS group 10 (identity 99.67%). The deduced LMW-GS contains nine cystine residues, which contained one more cystine residue in the C-terminal conserved domain than previous reported. This was the first LMW-GS gene encoding for a LMW-GS with 9 cystine residues that has been discovered so far.