Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins.

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.