YY1 is involved in RANKL-induced transcription of the tartrate-resistant acid phosphatase gene in osteoclast differentiation.

Receptor activator of nuclear factor kappa B (NF-kappaB) ligand (RANKL), a critical activator of osteoclast differentiation, plays a pivotal role in tartrate-resistant acid phosphatase (TRAP) gene expression. Previously, we showed that upstream stimulatory factors (USF) 1 and 2 are implicated in the RANKL-induced TRAP transcriptional activation via a 12-bp USF binding site in the TRAP promoter. In that study, we also demonstrated that a RANKL-induced nuclear protein binds to a 50-bp oligonucleotide (Oligo IV) corresponding to a distinct TRAP promoter region. Here we report the identification and functional characterization of the nuclear protein binding to Oligo IV. We identified a 21-bp sequence CTGTTTATGATGGCGAGGGGG in Oligo IV that specifically binds the RANKL-induced nuclear protein from RAW264.7 cells by performing a series of competition assays. Computer analysis of the 21-bp sequence revealed that the sequence contains a putative Yin Yang 1 (YY1) binding site overlapped with a putative activator protein-2 (AP-2) binding site. Competition and supershift assays indicated that the nuclear protein binding to the 21-bp sequence is YY1, not AP-2. Functionally, mutation of the YY1-binding site resulted in a reduction in the RANKL-induced TRAP transcription in RAW264.7 cells, demonstrating that YY1 positively regulates RANKL-induced TRAP transcriptional activation. In conclusion, our data demonstrated that YY1 plays a functional role in RANKL-mediated TRAP gene expression during osteoclast differentiation.