Purification and functional characterization of the KdgR protein, a major repressor of pectinolysis genes of Erwinia chrysanthemi.

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi kdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.