Literature DB >> 15447793

Prediction of DtxR regulon: identification of binding sites and operons controlled by Diphtheria toxin repressor in Corynebacterium diphtheriae.

Sailu Yellaboina1, Sarita Ranjan, Prachee Chakhaiyar, Seyed Ehtesham Hasnain, Akash Ranjan.   

Abstract

BACKGROUND: The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. RESULT: Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG), an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps) which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin.
CONCLUSIONS: We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase, a potential vaccine candidate and proteins of secretory system.

Entities:  

Mesh:

Substances:

Year:  2004        PMID: 15447793      PMCID: PMC524172          DOI: 10.1186/1471-2180-4-38

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Iron is an important inorganic component of a cell. Iron is required as co-factor for various essential enzymes and proteins some of which are involved in electron transport (Cytochromes), redox reactions (oxidoreductases) and regulation of gene expression (fumarate-nitrate reduction regulatory protein, iron-binding protein) [1]. However a higher level of intracellular iron can catalyze formation of hydroxyl radicals and reactive oxygen species through Fenton's reaction which could be lethal to the cell [2]. Hence, a careful regulation of iron-requiring enzymes/proteins and iron uptake proteins/enzymes is required for the survival of bacteria. Inorganic iron is also known to influence virulence in many pathogenic bacteria such as Corynebacterium diphtheriae, Escherichia coli, and Bordetella bronchiseptica [3-5]. The diphtheria toxin repressor DtxR is known as an iron-activated global transcription regulator that represses the transcription of various iron-dependent genes in C. diphtheriae [6,7]. Eight DtxR-binding sites in upstream sequences of operons/genes named as tox, hmuO, irp1, irp2, irp3, irp4, irp5 and irp6 have been identified by DNA footprinting methods [6]. The product of tox gene is diphtheria toxin which catalyzes the NAD-dependent ADP ribosylation of eukaryotic aminoacyl-transferase-II, thereby causing inhibition of protein synthesis and subsequent death of the host. The hmuO gene, which encodes a haem oxygenase, oxidizes the haem to release free iron. The operons irp1 and irp6 encode the products with homology to ABC-type ferric-siderophore transport systems. The gene irp3 encodes a homologue of AraC-type transcriptional activators. The products of irp2, irp4 and irp5 do not show any homology to the other known proteins. In addition, C. diphtheriae with inactive DtxR has been shown to be sensitive to killing by exposure to high iron conditions or hydrogen peroxide than the wild type [8]. This work uses an in silico method to identify additional DtxR-binding sites and target genes to understand the role of DtxR in virulence and patho-physiology of C. diphtheriae.

Results

In silico identification of putative DtxR-binding sites

Experimentally characterized DtxR-binding motifs were collected from the literature (Table 1). These binding sites were used to identify additional putative DtxR-binding sites along with associated operons in C. diphtheriae NCTC13129 genome (see materials and methods). Table 2 shows the predicted DtxR-binding sites with score 3.7438 or more. We could identify five (tox, irp4, irp5, irp6 and hmuO) of the eight known DtxR-binding sites, in sequenced C. diphtheriae NCTC13129 genome. We could not find irp1 and irp2 motifs as the corresponding genes (irp1, irp2) are not present in the sequenced strain NCTC13129 [9]. The regulator binding sites of irp3, irp4 and irp6 genes in the strain NCTC13129 shows one base change from the binding sites reported in strain C7 [6]. Binding site of irp3 gene (TTAGGTGAGACGCACCCAT) although exists in strain NCTC13129, but not there in the predicted sites, because it is located within the coding region of irp3 ORF. The predicted ORF of irp3 in the sequenced strain NCTC13129 has different start position and is larger than what was previously reported in strain C7 [9,10].
Table 1

Known DtxR-binding sites from C. diptheriae

Binding siteGeneProductReference
TTAGGATAGCTTTACCTAAtoxDiphtheria toxin[25]
TTAGGTTAGCCAAACCTTTIrp1Periplasmic protein of siderophore transport system[26]
GCAGGGTAGCCTAACCTAAIrp2Hypothetical protein[26]
TTAGGTGAGACGCACCCATIrp3AraC-type transcription regulator[10]
ATTACTAACGCTAACCTAAIrp4Hypothetical protein[10]
CTAGGATTGCCTACACTTAIrp5Hypothetical protein[10]
TTTCCTTTGCCTAGCCTAAIrp6Periplasmic protein of siderophore transport system[6]
TGAGGGGAACCTAACCTAAhmuOHaem oxygenase[27]
Table 2

Predicted DtxR-binding sites in C. diphtheriae

ScorePositionSiteGeneSynonymProduct
4.45904-80TGAGGGGAACCTAACCTAAhmuODIP1669**heme oxygenase
4.39003-52TTAGGATAGCTTTACCTAAToxDIP0222**Diphtheria toxin precursor
4.25877-60ATAGGCTACACTTACCTAA-DIP0624Putative membrane protein
4.21068-168TTGGATTAGCCTACCCTAA-DIP2162**ABC-type peptide transport system periplasmic component
4.2033-21TTAGGGTAGCTTCGCCTAAiucADIP0586Putative siderophore biosynthesis related protein
4.17632-78ATAGGCATGCCTAACCTCA-DIP2330Putative membrane protein
4.07921-130TTAGGTCAGGGTACCCTAA-DIP0370Putative succinate dehydrogenease cytochrome B subunit
4.03559-30TTAGCTTAACCTTGCCTATarsRDIP0415Putative ArsR family regulatory protein
4.01967-239TTAGGGTAGGCTAATCCAAsidA*DIP2161nonribosomal peptide synthase
3.99985-74TTTTCTTTGCCTAGCCTAAirp6ADIP0108**Ferrisiderophore receptor Irp6A
3.99195-241TTAGGCACCCCTAACCTAG-DIP0539Putative sugar ABC transport syste ATP-binding protein
3.98554-72TTAGCTTAGCCCTAGCTAA-DIP0169Putative secreted protein
3.9296-26CTAGGATTGCCTACACTTAIrp5DIP0894**Conserved hypothetical protein
3.9073-93GTTGGGTTGCCCAACCTAC-DIP2106Putative ABC transport system, ATP-binding subunit
3.89763-86ATAGGTTAGGTTAACCTTGchtA*DIP1520Putative membrane protein
3.89676-130TTGTGTTAGCCTAGGCTAAsecADIP0699Translocase protein
3.89169-26TTGGGGTGGCCTATCCTTA-DIP2304Putative DNA-repair glycosylase
3.88042-172TTAGGTAAGTGTAGCCTAThtaA*DIP0625Putative membrane protein
3.86534-69ATTACTAATGCTAACCTAAIrp4DIP2356**Putative conserved membrane protein
3.85539-173TTAGGGTGGGCTAACCTGCdeoR*DIP1296Putative DNA-binding protein
3.84889-75TTAGGGAACTCTTGCCTTApiuB*DIP0124Putative membrane protein
3.83816-121TTAGCTAGGGCTAAGCTAA-DIP0168Putative glycosyl transferase
3.83576-219GTAACAAAGGCAAGCCTAAxerDDIP1510Putative integrase/recombinase
3.8224-216ATAGGCAAGGTTAAGCTAA-DIP0417Putative membrane protein
3.81905-47GTTGGACAGGTTACCCTAAfrgA*DIP1061Putative iron-siderophore uptake system permease
3.8148-37TGTGGGCACACCAACCTAA-DIP2272possible sortase-like protein
3.76235-136TTGGGGTTGCCCTTCCTAA-DIP0142Hypothetical protein
3.76233-268CTAGGTTAGGGGTGCCTAAsecY*DIP0540preprotein translocase SecY subunit
3.74673-110TAAACATAGCCAAACCAAAnrdF1DIP1865ribonucleotide reductase beta-chain 1
3.7438-81TAAGGATAGGCCACCCCAADpsDIP2303Starvation inducible DNA-binding protein

Note: **Indicate the gene synonym with experimentally identified binding site in C. diphtheriae [6]. * Indicates the genes known to be regulated by DtxR [7]. The binding sites in Italics were verified by EMSA. The gene pairs, DIP0624-DIP0625, DIP2161-DIP2162, DIP0168-DIP0169, DIP0539-DIP0540 and DIP2303-DIP2304 are divergently transcribed and contain common regulatory regions.

In addition, we have identified binding sites in upstream sequences of eight genes recently reported to be regulated by DtxR [7]. However, our prediction differs from the previous report for five (secY, deoR, chtA, frgA, sidA) of the seven sites which were identified by BLAST search (Table 2). Our prediction agreed with the previous report that the genes such as recA (DIP1450) and ywjA (DIP1735) are not under a direct DtxR regulation as we could not detect any motif upstream to these gene with scores above the cutoff value [7].

Experimental validation of predicted binding sites

Since our approach to identify DtxR-regulated genes is purely computational in nature, we decided to test the validity of our predictions. A sample of predicted regulator binding motifs (Table 2) (upstream to ORFs: DIP2161, DIP0699, DIP0586, DIP2304, DIP2272) were experimentally verified by EMSA using IdeR, an orthologue of DtxR from M. tuberculosis. DtxR and IdeR are iron-dependent regulators. A pair wise sequence comparison of the two proteins shows a high (58%) overall sequence identity (similarity 72%) which increases further to 92% identity and 100% similarity in DNA recognition domain. In addition, the structural comparison of two regulators also shows a very similar 3D organization, suggesting that the IdeR regulator would be able to recognize the DtxR motif [11]. Synthetic double stranded oligonucleotides corresponding to DNA-binding sites were labeled with 32P and mixed with purified IdeR in presence of manganese ions and was assayed for the formation of DNA-protein complex using EMSA. Manganese was used as the divalent metal in the binding reactions on account of its redox stability compared with ferrous ion. Electrophoretic mobility of all five double stranded oligonucleotides tested was retarded by IdeR (Figure 1). However a synthetic motif (TTTTCATGACGTCTTCTAA) used as a negative control did not show any complex formation. These results indicate that the predicted DtxR-binding sites can indeed bind to DtxR.
Figure 1

IdeR binds the predicted DtxR-binding DNA fragments. 30 pmoles of IdeR was added to 32P-labelled DNA probes in the presence of 200 μM Mn2+, and complexes were resolved on a 7% Tris-borate polyacrylamide gel containing 150 μM Mn2+. Lane 1: Control gel retardation using Radiolabeled DNA motif without DtxR-binding site. Lane 2: Radiolabeled DIP2161 motif without IdeR. Lane 3: Radiolabeled DIP2161 motif with IdeR. Lane 4: Radiolabeled DIP0699 motif with IdeR. Lane 5: Radiolabeled DIP0586 motif with IdeR. Lane 6: Radiolabeled DIP2304 motif with IdeR. Lane 7: Radiolabeled DIP2272 motif with IdeR.

Identification and annotation of DtxR-regulated genes C. diphtheriae genome

In addition to the binding site prediction, we have also identified co-regulated genes (operons) downstream to the predicted DtxR-binding site (Table 3). Function of the proteins encoded by the putative genes in Table 2 and Table 3 was predicted by RPS-BLAST search against conserved domain database [12].
Table 3

Predicted DtxR-regulated operons in C. diphtheriae

SynonymGeneOrthologueProduct
DIP2158COG1131ABC-type transport system permease and ATPase component
DIP2159COG1131ABC-type transport system permease and ATPase component
DIP2160-COG3321Polyketide synthase modules and related proteins
DIP2161*-COG1020Non-ribosomal peptide synthetase modules and related proteins
 
DIP0586iucAPfam04183Catalyse discrete steps in biosynthesis of the siderophore aerobactin
DIP0587--Putative membrane protein
DIP0588--Putative membrane protein
 
DIP1059fepCCOG1120ABC-type cobalamin/Fe3+-siderophores transport systems
DIP1060fepGCOG4779ABC-type enterobactin transport system
DIP1061*fepDCOG0609ABC-type Fe3+-siderophore transport system
 
DIP2162ddpACOG0747ABC-type peptide transport system periplasmic component
DIP2163ddpBCOG0601ABC-type peptide/nickel transport systems permease components
DIP2164ddpCCOG1173ABC-type peptide/nickel transport systems permease components
DIP2165dpdDCOG0444ABC-type peptide/nickel transport systems ATPase component
 
DIP0169lraICOG0803ABC-type metal ion transport system, periplasmic component
DIP0170znuCCOG1121ABC-type Mn/Zn transport systems, ATPase component
DIP0171znuBCOG1108ABC-type Mn2+/Zn2+ transport systems, permease components
DIP0172znuBCOG1108ABC-type Mn2+/Zn2+ transport systems, permease components
DIP0173lraICOG0803ABC-type metal ion transport system, periplasmic component
 
DIP2106mdlBCOG1131ABC-type multidrug transport system, ATPase and permease component
DIP2107mdlBCOG1131ABC-type multidrug transport system, ATPase and permease component
 
DIP0625htaaPfam04213Haemin transporter associated protein
DIP0626hmuTCOG4558ABC-type haemin transport system
DIP0627hmuUCOG0609ABC-type Fe3+-siderophore transport system
DIP0628hmuVCOG4559ABC-type haemin transport system
DIP0629*htaaPfam04213Haemin transporter associated protein
 
DIP1519*htaapfam04213Haemin transporter associated protein
DIP1520*htaapfam04213Haemin transporter associated protein
 
DIP2303dpsCOG0783Starvation inducible DNA-binding protein
 
DIP2304-COG0266Formamidopyrimidine-DNA glycosylase
DIP2305-COG0063Predicted sugar kinase
 
DIP1510xerDCOG4974Site-specific recombinase
 
DIP1288--Conserved hypothetical protein
DIP1289uupCOG0488ATPase components of ABC transporters with duplicated ATPase domains
 
DIP1290-COG2151Predicted metal-sulfur cluster biosynthetic enzyme
DIP1291iscUCOG0822NifU homolog involved in Fe-S cluster formation
DIP1292csdCOG0520Selenocysteine lyase
DIP1293sufCCOG0396ABC-type transport system involved in Fe-S cluster assembly
DIP1294-COG0719ABC-type transport system involved in Fe-S cluster assembly
DIP1295sufBCOG0719ABC-type transport system involved in Fe-S cluster assembly
DIP1296*deoRCOG2345DeoR family transcriptional regulator
 
DIP0370--Putative succinate dehydrogenease (cytochrome b)
DIP0371-COG1053Succinate dehydrogenase/fumarate reductase
DIP0372-COG0479Succinate dehydrogenase/fumarate reductase
DIP0373--Putative membrane protein
DIP0374--Putative membrane protein
DIP0375--Putative membrane protein
DIP0376--Putative membrane protein
DIP0377--Putative membrane protein
 
DIP1864ctaDCOG0843Heme/copper-type cytochrome/quinol oxidases
DIP1865nrdF1COG0208Ribonucleotide reductase
DIP2330--Putative membrane protein
DIP2331-COG1012NAD-dependent aldehyde dehydrogenases
 
DIP0124*-Pfam03929Uncharacterized iron-regulated membrane protein (DUF337)
 
DIP0622--Putative membrane protein
DIP0623metACOG2021Homoserine acetyltransferase
DIP0624--Putative membrane protein
 
DIP0415-Pfam01022Bacterial regulatory protein
 
DIP0539-COG3839ABC-type sugar transport systems
 
DIP0168--Putative glycosyl transferase
 
DIP0417--Putative membrane protein
 
DIP0142--Hypothetical protein
DIP0143---
DIP0144tra8COG2826Transposase and inactivated derivatives
 
DIP2271--Putative membrane protein
DIP2272-COG3764Sortase (surface protein transpeptidase)
 
DIP0699secACOG0653Preprotein translocase subunit SecA (ATPase
DIP0700--Hypothetical protein
 
DIP0540*secYPfam00344Eubacterial secY protein
DIP0541AdkCOG0563Adenylate kinase and related kinases
DIP0542mapAMethionine aminopeptidase
DIP0543--Sialidases or neuraminidases;
DIP0544erfKPfam03734This family of proteins contains a conserved histidine and cysteine
DIP0545infACOG0361Translation initiation factor 1 (IF-1)
DIP0546rpsMCOG0099Ribosomal protein S13
DIP0547rpsKCOG0100Ribosomal protein S11
DIP0548rpsDCOG0522Ribosomal protein S4 and related proteins
DIP0549rpoACOG0202DNA-directed RNA polymerase
DIP0550rplQCOG0203Ribosomal protein L17
DIP0551truACOG0101Pseudouridylate synthase

Note: * Indicate the genes reported be regulated by DtxR. Genes listed together belongs to same operon.

Discussion

Our analysis identified putative DtxR motifs upstream to various operons/genes which could be involved in siderophore biosynthesis, ABC-type transport systems, iron storage, oxidative stress defense and iron-sulfur cluster biosynthesis. In addition, we have also identified the motifs upstream of operons that could be involved in anchoring of host-interacting proteins to the cell wall and secretion of various virulence factors. Important functions of some of these DtxR-regulated genes and their role in C. diphtheriae physiology are discussed here.

Regulation of siderophore biosynthesis and ABC-type transport systems

Predicted member of the DtxR regulon, the gene DIP0586, codes for the IucA/IucC family of enzymes that catalyze discrete step in the biosynthesis of the aerobactin [13]. In addition to known DtxR-regulated siderophore transport genes (irp1, irp6), DtxR could also regulate other ABC-type transport systems similar to Manganese/Zinc, peptide/Nickel and multidrug subfamilies of ABC transporters. The peptide/nickel transport system (DIP2162-DIP2165) has been suggested to be recently acquired by pathogenic C. diphtheriae [9].

Regulation of iron storage and oxidative stress defense

We predict that DtxR could regulate divergently transcribed genes DIP2303 and DIP2304 whose products are similar to starvation inducible DNA-binding protein (Dps) and Formamidopyrimidine-DNA glycosylase (Fpg), respectively. Dps in Escherichia coli is induced in response to oxidative or nutritional stress and protects DNA from oxidative stress damage by nonspecific binding [14]. Dps also catalyzes oxidation of ferrous iron to ferric iron by hydrogen peroxide (2Fe2+ + H2O2 + 2H2O → 2Fe+3OOH(core) + 4H+) which in turn prevents hydroxyl radical formation by Fenton's reaction (Fe2+ + H2O2Fe+3 + HO- + HO.) and thereby prevents subsequent DNA damage [15]. The enzyme, formamidopyrimidine-DNA glycosylase is a primary participant in the repair of 8-oxoguanine, an abundant oxidative DNA lesion [16]. The gene DIP1510 which codes for the site-specific recombinase XerD could also be regulated by DtxR. The xerD gene in E. coli belongs to the oxidative stress regulon [17].

Regulation of proteins involved in iron-sulfur cluster biosynthesis and iron-sulfur cluster containing proteins

We predict that the operon DIP1288-DIP1296, which is similar to the suf operon of E. coli, could be regulated by DtxR. The suf operon in bacteria encodes the genes for Fe-S cluster assembly machinery [18]. In addition, genes encoding the iron-sulfur containing proteins such as succinate dehydrogenase (Sdh), cytochrome oxidase (CtaD) and Ribonucleotide reductase (NrdF1) in C. diphtheriae also show DtxR motif in their upstream sequences.

Regulation of sortases

We predict that DtxR could regulate the recently acquired pathogenic island DIP2271-DIP2272, encoding the sortase srtA and hypothetical protein, respectively [9]. Sortases are membrane-bound trans-peptidases that catalyze the anchoring of surface proteins to the cell wall peptidoglycan [9]. Such systems are often used by gram-positive pathogens to anchor host-interacting proteins to the bacterial surface [19].

Regulation of protein translation and translocation system

DtxR could regulate two operons that contain genes DIP0699 (secA) and DIP0540 (secY) that code for the protein translocation system. The secY-containing operon, which is similar to the streptomycine operon spc from B. subtilis and other bacteria, involves the genes required for protein translation and translocation [20]. The operon contains additional sialidase gene (DIP0543) in comparison to non pathogenic Corynebacterium species. Activity of sialidase has been linked to virulence in several other microbial pathogens and may enhance fimbriae mediated adhesion in Corynebacterium diphtheriae by unmasking receptors on mammalian cells [9]. The Sec system can both translocate proteins across the cytoplasmic membrane and insert integral membrane proteins into it. The former proteins but not the latter possess N-terminal, cleavable, targeting signal sequences that are required to direct the proteins to the Sec system. Some of the DtxR-regulated genes including diphtheria toxin (Table 4) show predicted signal sequences by SignalP 3.0 [21] and hence they may play an important role in host interaction and virulence of Corynebacterium diphtheriae [9].
Table 4

DtxR-regulated genes containing the potential signal sequence

GeneProduct
DIP0222Diphtheria toxin
DIP0109IRP6B
DIP2356IRP4
DIP2162ABC-type peptide transport system periplasmic component
DIP0172Putative membrane protein
DIP2107Putative integral membrane transport protein
DIP0625Haemin transporter associated protein
DIP0626ABC-type haemin transport system
DIP0627ABC-type haemin transport system
DIP1519Haemin transporter associated protein
DIP0629Haemin transporter associated protein
DIP1520Haemin transporter associated protein
DIP2330Putative membrane protein
DIP0543Sialidases or neuraminidases

Conclusions

The bioinformatics method used to predict the targets of DtxR in C. diphtheriae NCTC13129 genome is promising, as some of the predicted targets were experimentally verified. The approach identified novel DtxR-regulated genes, which could play an important role in physiology of C. diphtheriae NCTC13129. DtxR, generally known as a repressor of diphtheriae toxin and iron siderophore/transport genes, can also regulate other metal ion transport genes, iron storage, oxidative stress, DNA-repair, biosynthesis of iron-sulfur cluster, Fe-S-cluster containing proteins, and even protein sortase and translocation systems.

Methods

Source of genome sequence

The complete genome sequence of C. diphtheriae was downloaded from NCBI ftp site [22], and the DtxR-binding sites identified by experimental methods were collected from literature [6,10,25-27].

Prediction of DtxR-binding sites

DtxR-binding site recognition profile was calculated by positional Shannon relative entropy method [23,24]. The positional relative entropy Qat position i in a binding site is defined as where b refers to each of the possible base (A, T, G, C), fis observed frequency of each base at position i and qis the frequency of base b in the genome sequence. The contribution of each base to the positional Shannon's relative entropy is calculated by multiplying positional frequency of each base with positional relative entropy. The binding site profile thus generated was used to scan upstream sequences of all the genes of the Corynebacterium diphtheriae genome. The score of each site is calculated as the sum of the respective positional Shannon relative entropy of each of the four possible bases. A maximally scoring site is selected from the upstream sequence of each gene. The lowest score among the input binding sites is considered as cut-off score. The sites scoring higher than the cut-off value are reported as potential binding sites conforming to the consensus sequence.

Prediction of operons

Co-directionally transcribed genes, downstream to the predicted binding site were selected as potential co-regulated genes (operons) according to one of the following criteria (a) Co-directionally transcribed orthologous gene pairs, conserved in at least 4 genomes; (b) genes belong to the same cluster of orthologous gene function category and the intergenic distance is less than 200 base pairs; (c) the first three letters in gene names are identical (gene names for putative genes were assigned from COG database); (d) intergenic distance is less than 90 base pairs [24].

Functional assignment of genes

The function of predicted genes was inferred using the RPS-BLAST search against conserved domain database [12]. These genes were further classified according to their function.

Expression and purification of IdeR

The iron-dependent regulator IdeR from M. tuberculosis was expressed from a recombinant pRSET vector containing the IdeR gene fused to a six His affinity tag (P. Chakhiyar unpublished). The expressed protein was first purified using Ni-NTA Metal Chelate Affinity chromatography; later it was desalted and concentrated using Centricon Ultra filtration device. The concentration of the recombinant protein was estimated using Bradford method.

Electrophoretic mobility shift assay

Double-stranded oligonucleotides containing the predicted binding motif (19 bp long) were end labeled with T4 polynucleotide kinase and [γ32P]-ATP and were incubated with the recombinant purified IdeR protein in a binding reaction mixture. The binding reaction mixture (20-μl total volume) contain the DNA-binding buffer (20 mM Tris-HCl [pH 8.0], 2 mM DTT, 50 mM NaCl, 5 mM MgCl2, 50% glycerol, 5 μg of bovine serum albumin per ml), 10 μg of poly(dI-dC) per ml (for nonspecific binding) and 200 μM MnCl2. The reaction mixture was incubated at room temperature for 30 min. Approximately 2 μl of the tracking dye (50% sucrose, 0.6% bromophenol blue) was added to the reaction mixture at the end of incubation and was loaded onto 7% polyacrylamide gel containing 150 μM MnCl2 in 1 × Tris-borate-EDTA buffer. The gel was electrophoresed at 200 V for 2 hours. Subsequently the gel was dried and exposed to Fuji Storage Phosphor Image Plates for 16 hours. The image plates were subsequently scanned in Fuji Storage Phosphor Imaging workstation.

List of abbreviations

DtxRDiphtheria toxin repressor; IdeR – Iron-dependent regulator; DpsDNA-binding protein from starved cells; RPS-BLAST – Reversed Position Specific – Basic Local Alignment Search Tool; EMSA – Electrophoretic Mobility Shift Assay

Authors' contributions

SY: carried out the computation, data analysis, and manuscript preparation. SR: Carried out the EMSA and drafted the manuscript. PC: provided the cloned IdeR construct, drafted the manuscript. SH: Manuscript preparation and coordination. AR: Design of the study and coordination. All authors read and approved the final manuscript.
  25 in total

1.  MDB: the Metalloprotein Database and Browser at The Scripps Research Institute.

Authors:  Jesus M Castagnetto; Sean W Hennessy; Victoria A Roberts; Elizabeth D Getzoff; John A Tainer; Michael E Pique
Journal:  Nucleic Acids Res       Date:  2002-01-01       Impact factor: 16.971

2.  Flavodoxin mutants of Escherichia coli K-12.

Authors:  P Gaudu; B Weiss
Journal:  J Bacteriol       Date:  2000-04       Impact factor: 3.490

3.  Improved prediction of signal peptides: SignalP 3.0.

Authors:  Jannick Dyrløv Bendtsen; Henrik Nielsen; Gunnar von Heijne; Søren Brunak
Journal:  J Mol Biol       Date:  2004-07-16       Impact factor: 5.469

4.  Characterization of iucA and iucC genes of the aerobactin system of plasmid ColV-K30 in Escherichia coli.

Authors:  V de Lorenzo; J B Neilands
Journal:  J Bacteriol       Date:  1986-07       Impact factor: 3.490

5.  Identification of a new iron-regulated virulence gene, ireA, in an extraintestinal pathogenic isolate of Escherichia coli.

Authors:  T A Russo; U B Carlino; J R Johnson
Journal:  Infect Immun       Date:  2001-10       Impact factor: 3.441

6.  Crystal structure of the iron-dependent regulator from Mycobacterium tuberculosis at 2.0-A resolution reveals the Src homology domain 3-like fold and metal binding function of the third domain.

Authors:  M D Feese; B P Ingason; J Goranson-Siekierke; R K Holmes; W G Hol
Journal:  J Biol Chem       Date:  2000-10-26       Impact factor: 5.157

7.  Reduced virulence of a Bordetella bronchiseptica siderophore mutant in neonatal swine.

Authors:  K B Register; T F Ducey; S L Brockmeier; D W Dyer
Journal:  Infect Immun       Date:  2001-04       Impact factor: 3.441

8.  Generation of *OH initiated by interaction of Fe2+ and Cu+ with dioxygen; comparison with the Fenton chemistry.

Authors:  N K Urbański; A Beresewicz
Journal:  Acta Biochim Pol       Date:  2000       Impact factor: 2.149

9.  Iron and hydrogen peroxide detoxification properties of DNA-binding protein from starved cells. A ferritin-like DNA-binding protein of Escherichia coli.

Authors:  Guanghua Zhao; Pierpaolo Ceci; Andrea Ilari; Laura Giangiacomo; Thomas M Laue; Emilia Chiancone; N Dennis Chasteen
Journal:  J Biol Chem       Date:  2002-05-16       Impact factor: 5.157

10.  Identification of a DtxR-regulated operon that is essential for siderophore-dependent iron uptake in Corynebacterium diphtheriae.

Authors:  Yilei Qian; John H Lee; Randall K Holmes
Journal:  J Bacteriol       Date:  2002-09       Impact factor: 3.490

View more
  12 in total

1.  Development and use of a selectable, broad-host-range reporter transposon for identifying environmentally regulated promoters in bacteria.

Authors:  Jennifer K Spinler; Sheryl L W Zajdowicz; Jon C Haller; Diana Marra Oram; Ronald E Gill; Randall K Holmes
Journal:  FEMS Microbiol Lett       Date:  2009-02       Impact factor: 2.742

2.  Three enhancements to the inference of statistical protein-DNA potentials.

Authors:  Mohammed AlQuraishi; Harley H McAdams
Journal:  Proteins       Date:  2012-11-12

3.  Housekeeping sortase facilitates the cell wall anchoring of pilus polymers in Corynebacterium diphtheriae.

Authors:  Anu Swaminathan; Anjali Mandlik; Arlene Swierczynski; Andrew Gaspar; Asis Das; Hung Ton-That
Journal:  Mol Microbiol       Date:  2007-10-04       Impact factor: 3.501

Review 4.  A role for the DtxR family of metalloregulators in gram-positive pathogenesis.

Authors:  A T Merchant; G A Spatafora
Journal:  Mol Oral Microbiol       Date:  2013-08-22       Impact factor: 3.563

5.  TiO2 photocatalysis damages lipids and proteins in Escherichia coli.

Authors:  Gaëlle Carré; Erwann Hamon; Saïd Ennahar; Maxime Estner; Marie-Claire Lett; Peter Horvatovich; Jean-Pierre Gies; Valérie Keller; Nicolas Keller; Philippe Andre
Journal:  Appl Environ Microbiol       Date:  2014-02-14       Impact factor: 4.792

Review 6.  Bacterial Stress Responses during Host Infection.

Authors:  Ferric C Fang; Elaine R Frawley; Timothy Tapscott; Andrés Vázquez-Torres
Journal:  Cell Host Microbe       Date:  2016-08-10       Impact factor: 21.023

7.  The complete genome sequence of Corynebacterium pseudotuberculosis FRC41 isolated from a 12-year-old girl with necrotizing lymphadenitis reveals insights into gene-regulatory networks contributing to virulence.

Authors:  Eva Trost; Lisa Ott; Jessica Schneider; Jasmin Schröder; Sebastian Jaenicke; Alexander Goesmann; Peter Husemann; Jens Stoye; Fernanda Alves Dorella; Flavia Souza Rocha; Siomar de Castro Soares; Vívian D'Afonseca; Anderson Miyoshi; Jeronimo Ruiz; Artur Silva; Vasco Azevedo; Andreas Burkovski; Nicole Guiso; Olivier F Join-Lambert; Samer Kayal; Andreas Tauch
Journal:  BMC Genomics       Date:  2010-12-30       Impact factor: 3.969

Review 8.  Evaluating phylogenetic congruence in the post-genomic era.

Authors:  Jessica W Leigh; François-Joseph Lapointe; Philippe Lopez; Eric Bapteste
Journal:  Genome Biol Evol       Date:  2011-06-28       Impact factor: 3.416

9.  iCR: a web tool to identify conserved targets of a regulatory protein across the multiple related prokaryotic species.

Authors:  Sarita Ranjan; Jayshree Seshadri; Vaibhav Vindal; Sailu Yellaboina; Akash Ranjan
Journal:  Nucleic Acids Res       Date:  2006-07-01       Impact factor: 16.971

10.  MycoperonDB: a database of computationally identified operons and transcriptional units in Mycobacteria.

Authors:  Sarita Ranjan; Ranjit Kumar Gundu; Akash Ranjan
Journal:  BMC Bioinformatics       Date:  2006-12-18       Impact factor: 3.169

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.