Literature DB >> 15150569

Somatic mutations of KIT in familial testicular germ cell tumours.

E A Rapley1, S Hockley, W Warren, L Johnson, R Huddart, G Crockford, D Forman, M G Leahy, D T Oliver, K Tucker, M Friedlander, K-A Phillips, D Hogg, M A S Jewett, R Lohynska, G Daugaard, S Richard, A Heidenreich, L Geczi, I Bodrogi, E Olah, W J Ormiston, P A Daly, L H J Looijenga, P Guilford, N Aass, S D Fosså, K Heimdal, S A Tjulandin, L Liubchenko, H Stoll, W Weber, L Einhorn, B L Weber, M McMaster, M H Greene, D T Bishop, D Easton, M R Stratton.   

Abstract

Somatic mutations of the KIT gene have been reported in mast cell diseases and gastrointestinal stromal tumours. Recently, they have also been found in mediastinal and testicular germ cell tumours (TGCTs), particularly in cases with bilateral disease. We screened the KIT coding sequence (except exon 1) for germline mutations in 240 pedigrees with two or more cases of TGCT. No germline mutations were found. Exons 10, 11 and 17 of KIT were examined for somatic mutations in 123 TGCT from 93 multiple-case testicular cancer families. Five somatic mutations were identified; four were missense amino-acid substitutions in exon 17 and one was a 12 bp in-frame deletion in exon 11. Two of seven TGCT from cases with bilateral disease carried KIT mutations compared with three out of 116 unilateral cases (P=0.026). The results indicate that somatic KIT mutations are implicated in the development of a minority of familial as well as sporadic TGCT. They also lend support to the hypothesis that KIT mutations primarily take place during embryogenesis such that primordial germ cells with KIT mutations are distributed to both testes.

Entities:  

Mesh:

Substances:

Year:  2004        PMID: 15150569      PMCID: PMC2410291          DOI: 10.1038/sj.bjc.6601880

Source DB:  PubMed          Journal:  Br J Cancer        ISSN: 0007-0920            Impact factor:   7.640


Testicular germ cell tumours (TGCTs) are the most common malignancy in males between the age 15 and 45 years (Ferlay ). There are several risk factors for TGCT including previously diagnosed TGCT, undescended testis (UDT) and a family history of the disease. TGCT has been one of the highest familial relative risks of any cancer syndrome with reported increased risks of 8–10-fold to brothers and 4–6-fold to fathers (Forman ; Heimdal ). We previously described linkage of familial testicular cancer to a locus (TGCT1) at Xq27 (Rapley ). This locus was particularly strongly associated with families characterised by at least one case of bilateral testicular cancer. The results indicated, however, that only a minority of families are attributable to this locus and that additional TGCT susceptibility genes are likely to exist. The KIT gene encodes a type III transmembrane tyrosine kinase receptor. KIT is expressed in several cell types where it regulates primordial germ cell migration, proliferation and apoptosis during foetal gonad development (Mauduit ). KIT has been shown to be expressed in some TGCT (Strohmeyer ; Bokemeyer ) and somatic mutations in KIT have recently been identified in testicular (Tian ) and mediastinal germ cell tumours (Przygodzki ). Mutations have been reported in a high proportion of patients with bilateral disease, and in a much smaller proportion of unilateral cases (Looijenga ). When both tumours from bilateral cases could be examined, the same mutation was present in both tumours. Together, these results suggest that somatic KIT mutations occur early in embryogenesis, before the primordial germ cells have divided and migrated to the gonads. As a consequence, primordial germ cells with KIT mutations are distributed to both testes and hence KIT mutations are associated with bilateral disease (Looijenga ). Previous studies have indicated that KIT mutations found in germ cell tumours are somatic. To investigate further the role of KIT in predisposition to TGCT, and the role of somatic mutations in familial tumours, we have examined a series of constitutional and tumour DNAs from patients with TGCTs and a family history of the disease.

MATERIALS AND METHODS

The International Testicular Cancer Linkage Consortium (ITCLC) has obtained samples from 326 families with two or more cases of TGCT (Table 1 ). For this study, we analysed DNA extracted from blood lymphocytes (constitutional DNA) from one affected individual from each of 240 families, for whom the DNA was most readily available. The pedigree structure for these families is shown in Table 1. We also examined tumour materials from 123 cases from 93 families; for 15 of these families, the tumour material only was available and these were therefore not included in the 240 constitutional DNA set (Table 1). Seven tumours were from patients with bilateral disease, but the tumour material was only available from one of each pair of tumours arising in these patients.
Table 1

Pedigree structure of cases with family history of TGCT used in KIT mutation search

Family typePedigrees (by type) identified by ITCLCNumber of pedigrees analysed (by type) using constitutional DNANumber of pedigrees analysed (by type) using DNA from tumour material
Sib trios852
Large⩾3 affected cases31223
Sib pairs15410643 (11)a
Father/son pairs524616 (2)a
Cousin pairs403314
Uncle/nephew pairs322313 (2)a
Grandfather/grandson pairs451
Monozygous twins400
Great grandfather/great grandson pairs101
    
Total32624093

Number in brackets represents pedigrees (by subtype) for which only tumour material was available for analysis, these families are not included in the KIT analysis of constitutional DNA samples.

Number in brackets represents pedigrees (by subtype) for which only tumour material was available for analysis, these families are not included in the KIT analysis of constitutional DNA samples. Patients donated samples and medical information with full informed consent and with local or national ethical review board approval. Information on clinical status including type of TGCT, age of diagnosis, presence of UDT and laterality of disease was confirmed by reviewing histological reports and clinical notes. DNA was prepared from whole blood and from formalin-fixed, paraffin-embedded tumour sections using standard techniques. The tumour material was microdissected to minimise contamination by surrounding normal tissue. Primer sequences for KIT were designed from the KIT mRNA and genomic sequence (Ensembl gene ID=ENSG00000157404), using the Primer3 software (http://www-genome.wi.mit.edu/c gi-bin/primer/primer3_www.cgi). Primer sequences for the 21 KIT exons and PCR product sizes are shown in Table 2 . Exons>400 bp were amplified using overlapping primer pairs. A total of 23 primers pairs were used to examine the coding region of the KIT gene. Primers designed for exon 1 failed to amplify under a variety of PCR conditions and were redesigned but again failed to give a PCR product. Exon 1 was therefore not examined. Mutations of KIT are predominantly located in exons 10, 11 and 17 (Pignon ; Tian ; Rubin ; Przygodzki ; Looijenga ); therefore, the tumour material was examined only at these exons. Primers generating a smaller sized PCR fragment were designed for exons 10, 11 and 17 to allow easy amplification from paraffin-embedded material and were specifically used to analyse the tumour material.
Table 2

KIT gene primer pairs

ExonForwardReversePCR product size
Exon2aAATAGCAGGGCAGCTTTGTCGTTGGTGCACGTGTATTTGC358
Exon2bCTTGGCAGGCTCTTCTCAACCCTTCTAGACCCAGCCAGAA395
Exon3aGTGCGTGATACATGGAAAGCGTAGGCGCGTTTCACACTTT397
Exon3bGCTTCTATAGATCCTGCCAAGCAGGTGGATCAACGAGAAGAGA372
Exon4GATAGGTTAGCACCATGCTTTGTCTCCCAGACAATCCACCTC400
Exon5TGGAGAAGTTAATTGCTGCTATTTTTCATTCATTCAGTGATAACAAAATTC389
Exon6GGAAATCAACCAATTGTTTTTGTCGTGGATTTACGGGTTACA384
Exon7CCTCAAACAGGCATAGATTTCCAACCACCAAACCACGAAGTC364
Exon8TTCTGCCCTTTGAACTTGCTAAAGCCACATGGCTAGAAAAA386
Exon9ATGCCACATCCCAAGTGTTTTGACATGGTCAATGTTGGAA364
Exon10AACCAAGGTGAAGCTCTGAGACCTCCTCAACAACCTTCCACTG384
Exon 10 smallATCCCATCCTGCCAAAGTTCTGTGGGGAGAAAGGGAAA246
Exon11TAGCTGGCATGATGTGCATTGGCGCAATTTCACAGAAAAC397
Exon 11 smallAGAGTGCTCTAATGACTGAGACAAAAACAAAGGAAGCCACTGGA279
Exon12ATTGCGCCCCTTTTGATAGGTTCAGACATGAGGGCTTCC392
Exon13TGCTCAAGCGTAAGTTCCTGGCAAGAGAGAACAACAGTCTGG335
Exon14aCTCCACATAAGGCTGCTTTTCCCATGAACTGCCTGTCAAC381
Exon14bTCTCACCTTCTTTCTAACCTTTTCTCAGCAAAAATCTAGGTTTGAATC390
Exon15TGTAGCAAAGGGGATGAGGACCCTAACTGCCATTGACCAT335
Exon16GATCTGCCTGCAAGTTCACAAAAACACAAAACTCTTTAGAGAATCAC385
Exon17CATCATTCAAGGCGTACTTTTGTCCCTAGACAGGATTTACATTATGA399
Exon 17 smallTAAATGGTTTTCTTTTCTCCTCCATTCGATAAAATTGTTTCCTGTGA233
Exon18CTCCACATTTCAGCAACAGCGGCTGCTTCCTGAGACACA333
Exon19AAGTGGATGGCACCTGAAAGCCCTCAACATCTGGGTTTCT390
Exon20TCCATATGTCCAGTTGCATAGCGCCCAATTTGCAACCTAAGA350
Exon21TTCCATCAGTTAGTTGTGATCTTGGACAAAAATCATCGGCCACT390
For constitutional DNA, all exons were examined by conformation sensitive gel electrophoresis (CSGE) (Ganguly ). Briefly, both PCR primers were labelled with adenosine 5′[γ-32P]triphosphate by T4 polynucleotide kinase. After amplification, PCR products were heated to 98°C and cooled down to 60°C over 30 min to allow heteroduplex formation. PCR samples were run on a CSGE gel (10% v v−1 ethanediol, 13.75% v v−1 formamide, 15% v v−1 acrylamide with 4 mg ml−1 piperazine and 1 × GTB buffer (89 mM Tris, 29 mM taurine and 0.5 mM EDTA). Polymerase chain reaction (PCR) products from samples that showed migration shifts on CSGE were bidirectionally sequenced using the BigDye terminator v3 sequencing kit and a 3100 automated sequencer (Applied Biosystems, Warrington, UK). All tumour samples were examined for exons 10, 11 and 17 of the KIT gene by direct sequencing. The tumour material was amplified and sequenced using specifically designed primers that generated a smaller sized PCR fragment than those designed for CSGE analysis and allowed for ease of amplification from tumour material. Sequencing was performed using the BigDye terminator v3 sequencing kit and a 3100 automated sequencer (Applied Biosystems). Differences in distribution between categorical variables were assessed with the appropriate contingency table test.

RESULTS AND DISCUSSION

In total, 240 constitutional DNA samples from TGCT cases with a positive family history were examined using CSGE. Two conservative nonsynonymous constitutional sequence variants were detected, M541L and V399I (Table 3 ). M541L was found in 43 out of 240 (17.9%) cases and it is a common polymorphism found in 32 out of 192 (16.6%) of normal controls. V399L was found in only a single case and was not found in 200 controls. V399 is not conserved in other species (mouse, zebrafish and xenopus) and the amino-acid substitution is conservative, suggesting that this variant is a rare polymorphism rather than a disease-causing change. Overall, the results provide no evidence that germline KIT mutations are associated with an increased risk of testicular cancer.
Table 3

Sequence variants in KIT detected in constitutional DNA from patients with familial TGCTs

ExonNucleotide change RefSeq NM_000222Amino-acid changeNumber of cases
3G525AA168A1
6C999TN326N1
7G1216AV399I1
10A1642CM541L43
10A1659GK546K5
16C2370TL783L1
17C2451TI798I12
18G2607CL862L53
19G2643AP874P1
Somatic mutations of KIT were detected in five out of 123 TGCTs examined (Table 4 and Figure 1). Three mutations involved codon 816, a known hotspot for KIT mutations in testicular (Tian ; Przygodzki ; Looijenga ) and other cancers (Rubin ). Another mutation involved codon 820, an infrequently mutated residue but one that has been previously reported (Pignon ). The fifth mutation was a 12 bp deletion encoding a 4 amino-acid in-frame deletion in the cytoplasmic juxamembrane domain of KIT. In-frame deletions of this region are common in gastrointestinal stromal tumours (GIST) (Rubin ) but have not been documented in TGCT. All these mutations were shown to be somatic. Two out of seven (28.5%) familial bilateral cases carried a somatic KIT mutation compared with three out of 116 (2.6%) familial unilateral cases (P=0.026, Fisher's exact test). Unfortunately, samples of the other tumour/ITGCN from the two bilateral cases with KIT mutations were not available to evaluate the presence of the mutations. While the frequency of KIT mutations in unilateral TGCT is similar to that detected previously, the proportion of cases with bilateral disease is much lower despite the fact that we examined a larger proportion of the KIT gene than in the study by Looijenga . The reason for this is unclear. However, it may indicate that bilateral disease in the context of familial testicular cancer has a different pathogenesis from sporadic bilateral cases and that most of the familial bilateral cases are explained by the elevated risk conferred by the underlying susceptibility genes. Nevertheless, the overall pattern of an elevated frequency of KIT mutations in bilateral compared to unilateral cases supports the observation of Looijenga and suggests that somatic KIT mutations may take place early in development.
Table 4

Sequence changes in KIT detected in TGCTs

Sample nameExonNucleotide change RefSeq NM_000222Amino-acid changeCase details giving tumour type, age at diagnosis, history of undescended testis and family history
2158-20111Del 1675–1686del MYEV AA 552–555R. sema and L.ITGCN
    Age at diagnosis=39 years
    History of bilateral UDT
    Family history=sib pair
274-20117A2480GD820GL. sem
    Age at diagnosis=52 years
    Family history=MZ twins (twin brother has bilateral disease, no tumour available for this patient)
295-30417G2467CD816HR. mixed and L. sema
    Age at diagnosis=39 and 55 years
    History of UDT
    Family history=sib trio
377-166417G2467TD816YR NS
    Age at diagnosis=66 years
    Family history=father/son pair
285-20117G2467TD816YL. sem
    Age at diagnosis=39 years
    Family history=sib pair

Tumour examined in bilateral cases. Sem=Seminoma; NS=nonseminoma; ITGCN=intratubular germ cell neoplasia; R=right side; L=left side; UDT=undescended testis.

Figure 1

Chromatograms showing sequence variants in KIT gene sequence in testicular tumours: (1a) exon 11 reverse sequence showing 2158-201 12 bp deletion; (1b) exon 11 wild-type sequence; (2) tumour 274-201 forward (a) and reverse (b) exon 17 sequence showing A → G variant; (3) tumour 295-304 forward (a) and reverse (b) exon 17 sequence showing G → C change; (4) tumour 377-1664 forward (a) and reverse (b) exon 17 sequence showing G → T variant; (5) tumour 285-201 forward (a) and reverse (b) exon 17 sequence showing G → T variant.

Tumour examined in bilateral cases. Sem=Seminoma; NS=nonseminoma; ITGCN=intratubular germ cell neoplasia; R=right side; L=left side; UDT=undescended testis. Chromatograms showing sequence variants in KIT gene sequence in testicular tumours: (1a) exon 11 reverse sequence showing 2158-201 12 bp deletion; (1b) exon 11 wild-type sequence; (2) tumour 274-201 forward (a) and reverse (b) exon 17 sequence showing A → G variant; (3) tumour 295-304 forward (a) and reverse (b) exon 17 sequence showing G → C change; (4) tumour 377-1664 forward (a) and reverse (b) exon 17 sequence showing G → T variant; (5) tumour 285-201 forward (a) and reverse (b) exon 17 sequence showing G → T variant. In conclusion, our results indicate that constitutional mutations of KIT are not associated with a substantially increased risk of TGCT. Somatic mutations of KIT are found in familial TGCT tumours with a higher proportion in cases with bilateral disease. Overall, the proportion of KIT mutations in TGCT is low and other somatic and susceptibility genes must play important roles.
  12 in total

1.  Localization to Xq27 of a susceptibility gene for testicular germ-cell tumours.

Authors:  E A Rapley; G P Crockford; D Teare; P Biggs; S Seal; R Barfoot; S Edwards; R Hamoudi; K Heimdal; S D Fossâ; K Tucker; J Donald; F Collins; M Friedlander; D Hogg; P Goss; A Heidenreich; W Ormiston; P A Daly; D Forman; T D Oliver; M Leahy; R Huddart; C S Cooper; J G Bodmer; D F Easton; M R Stratton; D T Bishop
Journal:  Nat Genet       Date:  2000-02       Impact factor: 38.330

2.  KIT activation is a ubiquitous feature of gastrointestinal stromal tumors.

Authors:  B P Rubin; S Singer; C Tsao; A Duensing; M L Lux; R Ruiz; M K Hibbard; C J Chen; S Xiao; D A Tuveson; G D Demetri; C D Fletcher; J A Fletcher
Journal:  Cancer Res       Date:  2001-11-15       Impact factor: 12.701

Review 3.  Stem cell factor/c-kit system in spermatogenesis.

Authors:  C Mauduit; S Hamamah; M Benahmed
Journal:  Hum Reprod Update       Date:  1999 Sep-Oct       Impact factor: 15.610

4.  Conformation-sensitive gel electrophoresis for rapid detection of single-base differences in double-stranded PCR products and DNA fragments: evidence for solvent-induced bends in DNA heteroduplexes.

Authors:  A Ganguly; M J Rock; D J Prockop
Journal:  Proc Natl Acad Sci U S A       Date:  1993-11-01       Impact factor: 11.205

5.  Activating c-kit gene mutations in human germ cell tumors.

Authors:  Q Tian; H F Frierson; G W Krystal; C A Moskaluk
Journal:  Am J Pathol       Date:  1999-06       Impact factor: 4.307

6.  Primary mediastinal seminomas: evidence of single and multiple KIT mutations.

Authors:  Ronald M Przygodzki; Alan E Hubbs; Feng-Qi Zhao; Timothy J O'Leary
Journal:  Lab Invest       Date:  2002-10       Impact factor: 5.662

7.  Stem cell factor receptor (c-KIT) codon 816 mutations predict development of bilateral testicular germ-cell tumors.

Authors:  Leendert H J Looijenga; Hubert de Leeuw; Monique van Oorschot; Ruud J H L M van Gurp; Hans Stoop; Ad J M Gillis; Carlos A de Gouveia Brazao; Rob F A Weber; Wim J Kirkels; Thamar van Dijk; Marieke von Lindern; Peter Valk; Geczy Lajos; Edit Olah; Jahn M Nesland; Sophie D Fosså; J Wolter Oosterhuis
Journal:  Cancer Res       Date:  2003-11-15       Impact factor: 12.701

8.  Expression of the c-kit proto-oncogene and its ligand stem cell factor (SCF) in normal and malignant human testicular tissue.

Authors:  T Strohmeyer; D Reese; M Press; R Ackermann; M Hartmann; D Slamon
Journal:  J Urol       Date:  1995-02       Impact factor: 7.450

9.  Familial testicular cancer: a report of the UK family register, estimation of risk and an HLA class 1 sib-pair analysis.

Authors:  D Forman; R T Oliver; A R Brett; S G Marsh; J H Moses; J G Bodmer; C E Chilvers; M C Pike
Journal:  Br J Cancer       Date:  1992-02       Impact factor: 7.640

10.  Familial testicular cancer in Norway and southern Sweden.

Authors:  K Heimdal; H Olsson; S Tretli; P Flodgren; A L Børresen; S D Fossa
Journal:  Br J Cancer       Date:  1996-04       Impact factor: 7.640

View more
  25 in total

Review 1.  Testicular germ cell tumours: predisposition genes and the male germ cell niche.

Authors:  Duncan Gilbert; Elizabeth Rapley; Janet Shipley
Journal:  Nat Rev Cancer       Date:  2011-03-17       Impact factor: 60.716

2.  Cytoplasmic p21 expression levels determine cisplatin resistance in human testicular cancer.

Authors:  Roelof Koster; Alessandra di Pietro; Hetty Timmer-Bosscha; Johan H Gibcus; Anke van den Berg; Albert J Suurmeijer; Rainer Bischoff; Jourik A Gietema; Steven de Jong
Journal:  J Clin Invest       Date:  2010-09-01       Impact factor: 14.808

Review 3.  Familial testicular germ cell tumours.

Authors:  Christian P Kratz; Phuong L Mai; Mark H Greene
Journal:  Best Pract Res Clin Endocrinol Metab       Date:  2010-06       Impact factor: 4.690

Review 4.  Testicular cancer: biology and biomarkers.

Authors:  Leendert H J Looijenga; Hans Stoop; Katharina Biermann
Journal:  Virchows Arch       Date:  2014-02-01       Impact factor: 4.064

5.  The stem cell factor (SCF)/c-KIT signalling in testis and prostate cancer.

Authors:  Henrique J Cardoso; Marília I Figueira; Sílvia Socorro
Journal:  J Cell Commun Signal       Date:  2017-06-27       Impact factor: 5.782

Review 6.  [Advances in basic research on testicular germ cell tumors : clinical implications].

Authors:  L H J Looijenga
Journal:  Urologe A       Date:  2009-04       Impact factor: 0.639

Review 7.  [Value of targeted treatment for testicular cancer: from molecular approaches to clinical possibilities].

Authors:  A Martinschek; C G Ruf; C Sparwasser; H U Schmelz
Journal:  Urologe A       Date:  2008-10       Impact factor: 0.639

8.  Cyclic AMP and c-KIT signaling in familial testicular germ cell tumor predisposition.

Authors:  Monalisa F Azevedo; Anelia Horvath; Ethan R Bornstein; Madson Q Almeida; Paraskevi Xekouki; Fabio R Faucz; Evgenia Gourgari; Kiran Nadella; Elaine F Remmers; Martha Quezado; Rodrigo Bertollo de Alexandre; Christian P Kratz; Maria Nesterova; Mark H Greene; Constantine A Stratakis
Journal:  J Clin Endocrinol Metab       Date:  2013-06-14       Impact factor: 5.958

Review 9.  Using germline genotype in cancer pharmacogenetic studies.

Authors:  Sarah R McWhinney; Howard L McLeod
Journal:  Pharmacogenomics       Date:  2009-03       Impact factor: 2.533

10.  Clinical and genetic aspects of testicular germ cell tumours.

Authors:  Martijn F Lutke Holzik; Rolf H Sijmons; Josette Ehm Hoekstra-Weebers; Dirk T Sleijfer; Harald J Hoekstra
Journal:  Hered Cancer Clin Pract       Date:  2008-02-15       Impact factor: 2.857

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.