Literature DB >> 15113427

The defH9-iaaM auxin-synthesizing gene increases plant fecundity and fruit production in strawberry and raspberry.

Bruno Mezzetti1, Lucia Landi, Tiziana Pandolfini, Angelo Spena.   

Abstract

BACKGROUND: The DefH9-iaaM gene fusion which is expressed specifically in placenta/ovules and promotes auxin-synthesis confers parthenocarpic fruit development to eggplant, tomato and tobacco. Transgenic DefH9-iaaM eggplants and tomatoes show increased fruit production due mainly to an improved fruit set. However, the weight of the fruits is also frequently increased.
RESULTS: DefH9-iaaM strawberry and raspberry plants grown under standard cultivation conditions show a significant increase in fruit number and size and fruit yield. In all three Rosaceae species tested, Fragaria vesca, Fragaria x ananassa and Rubus idaeus, DefH9-iaaM plants have an increased number of flowers per inflorescence and an increased number of inflorescences per plant. This results in an increased number of fruits per plant. Moreover, the weight and size of transgenic fruits was also increased. The increase in fruit yield was approximately 180% in cultivated strawberry, 140% in wild strawberry, and 100% in raspberry. The DefH9-iaaM gene is expressed in the flower buds of all three species. The total IAA (auxin) content of young flower buds of strawberry and raspberry expressing the DefH9-iaaM gene is increased in comparison to untransformed flower buds. The DefH9-iaaM gene promotes parthenocarpy in emasculated flowers of both strawberry and raspberry.
CONCLUSIONS: The DefH9-iaaM gene is expressed and biologically active in Rosaceae. The DefH9-iaaM gene can be used, under cultivation conditions that allow pollination and fertilization, to increase fruit productivity significantly in Rosaceae species. The finding that the DefH9-iaaM auxin-synthesizing gene increases the number of inflorescences per plant and the number of flowers per inflorescence indicates that auxin plays a role in plant fecundity in these three perennial Rosaceae species.

Entities:  

Mesh:

Substances:

Year:  2004        PMID: 15113427      PMCID: PMC394336          DOI: 10.1186/1472-6750-4-4

Source DB:  PubMed          Journal:  BMC Biotechnol        ISSN: 1472-6750            Impact factor:   2.563


Background

Flowering and fruiting are developmental processes of both heuristic and applied interest. In this regard, modification of flowering and fruiting can improve agricultural production in both a quantitative and qualitative manner. We have developed a biotechnological strategy based on the DefH9-iaaM gene construct, which is composed of the regulatory region of the DefH9 gene from snapdragon and the iaaM coding region from Pseudomonas syringae pv savastanoi. In horticultural plants grown for the value of their fruits, it has been already shown that: i) the placenta/ovule-specific expression of the DefH9-iaaM gene confers parthenocarpic fruit development to eggplant and tomato [1,2]; ii) under the cultivation conditions tested, either protected or open field cultivation, transgenic DefH9-iaaM eggplants show a significant increase in fruit production, averaging between 30–35% extra fruit, concomitant with improved fruit quality and a reduction in cultivation costs [3-5]; iii) DefH9-iaaM tomato plants, grown under protected cultivation during spring, show a significant increase in fruit productivity ranging between 60% and 250% in the four different lines tested [6]; iv) by using an optimized gene version, namely the DefH9-RI (Reduced by Intron)-iaaM gene, high quality fruit development has been achieved also in an industrial tomato cultivar that is hypersensitive to auxin [7] (for a review of patents and methods to induce parthenocarpy, see [6]); v) the increased productivity conferred on eggplant and tomato plants is mainly due to improved fruit set, although the weight of the fruit is also often increased [4,6,7]; vi) consistent with the known function of the iaaM gene product, which converts tryptophane to indole-3-acetamide which is then hydrolysed to the auxin indole acetic acid (IAA), DefH9-iaaM flower buds have an higher auxin (i.e. total IAA) content than controls [7]. In the present study we have evaluated, under environmental conditions permitting pollination and fertilization, the effects caused by the expression of the DefH9-iaaM gene in fruit species belonging to the Rosaceae. Both wild and cultivated strawberry and raspberry are fruit-bearing species cultivated for the high quality and value of their fruits. In the present study we have shown that introduction of the DefH9-iaaM gene construct causes a significant increase in fruit production which results from an increase in individual fruit weight, an increased number of fruits per inflorescence and an increased number of inflorescences per plant. Fruit production data are based on fruits bearing seeds. Thus, in Rosaceae, the increase in fruit production is due neither to parthenocarpic fruit development nor to enhanced fruit set but to increased plant fecundity, and only in minor part to enhanced fruit weight. Strawberry inflorescences are modified stems emerging from the strawberry crown (i.e. stem) [8]. Each strawberry inflorescence terminates with a primary blossom, typically followed by two secondaries, four tertiaries and, eventually, eight quaternaries [8]. Carpel number ranges from 600 in primary blossoms to 60 in quaternaries. To produce a well-shaped strawberry fruit, at least one-third of the carpels must be fertilized [8]. The growth of the strawberry receptacle, which is what comprises the 'commercial fruit', is controlled primarily by auxin synthesized by the fertilized ovules, the achenes [9]. When the achenes are removed, fruit (i.e. receptacle) growth is inhibited [9]. However, exogenous auxin can replace the achenes in inducing and sustaining growth of the receptacle [10]. Several factors, including poor pollination due to adverse climatic conditions and biotic and/or abiotic injuries to the fertilized ovules, result in the development of malformed strawberry fruits [11]. In this study, we have used both wild strawberry (diploid) and cultivated strawberry (octaploid). The wild strawberry, Fragaria vesca cv Alpina W Original, is an ever-bearing plant, i.e. it has an indeterminate flowering habit, whilst the cultivated strawberry (Fragaria x ananassa) breeding selection has a determinate flowering habit. Raspberry (Rubus idaeus) is another species belonging to Rosaceae. This plant has an aggregate fruit composed of multiple drupelets, each one developing from a single ovary. All the drupelets of a raspberry fruit derive from the ovaries of the same flower and adhere to a common receptacle [12]. In plants grown for the value of their fruits, an increase in productivity can be achieved by increasing one or more of the following parameters: fruit weight, number of fruits per inflorescence, and/or number of inflorescences per plant. The present study shows that under standard cultivation conditions, i.e. allowing pollination and fertilization, the DefH9-iaaM gene increases fruit productivity in three perennial species (i.e. wild strawberry, cultivated strawberry, raspberry) belonging to the Rosaceae. The increase in fruit production results from an increase of all three of the aforementioned parameters (fruit weight, fruit number per inflorescence, and number of inflorescences per plant). The increase in fruit production does not affect the total sugar content of fruit, a parameter related to fruit quality. Moreover, our data indicate a new role for auxin in plant fecundity (i.e. number of flowers per inflorescence and number of inflorescences per plant) in these three related perennial crop species. This work also shows that in all three species analyzed, the DefH9-iaaM gene causes parthenocarpic fruit development, a finding that confirms and extends the previous results in Solanaceous crops [1,2,6].

Results

Strawberry and raspberry plants transgenic for the DefH9-iaaM gene

The transgenic state of plants transformed with the DefH9-iaaM gene was analyzed by Southern blot (Fig. 1). The two transgenic F. vesca lines used in this study had either one (line 1) or three (line 2) copies of the DefH9-iaaM gene (Fig. 1, panel a, lanes 2 and 3, respectively). The transgenic F. x ananassa line used in this work had three copies of the DefH9-iaaM gene (Fig. 1, panel b, lane 2), while the transgenic raspberry line had a single copy of the DefH9-iaaM gene (Fig. 1, panel c, lane 2). DefH9-iaaM transgenic strawberry plants and their corresponding controls were micropropagated and after acclimatization grown under greenhouse conditions. DefH9-iaaM raspberry plants after acclimatization were transferred to the field and grown under open field conditions.
Figure 1

Southern blot analysis of strawberry and raspberry plants transgenic for DefH9-iaaM. Genomic DNA digested with HindIII from: F. vesca control plants (panel a, lane1), and transgenic lines 1 and 2 (panel a, lanes 2, 3 respectively); F. x ananassa control plants (panel b, lane1) and transgenic line 1 (panel b, lane 2); R. idaeus control plants (panel c, lane 1) and transgenic line 1 (panel c, lane 2). The blots were probed with a 589 bp DNA fragment of the iaaM coding region that does not contain the HindIII site present in the iaaM coding region. The probe was obtained by PCR using the following primers 5'AAACAAGCTTCCCACCACCATCCAG3' and 5'CATGCTCTTTTCACCCGTATTAG3'.

Expression of the DefH9-iaaM gene in transgenic plants

Expression of the DefH9-iaaM gene was analyzed by RT-PCR (Fig. 2). All transgenic plants showed an amplicon of the expected size (i.e. 149 bp; Fig. 2, panels a and b), and sequence (not shown). The steady state level of DefH9-iaaM mRNA was estimated by real time RT-PCR by using mRNA extracted from young flower buds. F. vesca line 1 had a DefH9-iaaM mRNA steady state level of 0.5 × 10-9 of the total mRNA population present in young flower buds, while F. vesca line 2 had a steady state level of 4 × 10-9. In DefH9-iaaM F. x ananassa flower buds, the mRNA steady state level was estimated to be 0.5 × 10-9. In the transgenic raspberry, the steady state level of DefH9-iaaM mRNA, as estimated by RT-PCR, was 2 × 10-9 of the total mRNA population of young flower buds. Thus, the DefH9-iaaM gene is expressed in strawberry and raspberry flower buds at a steady state level comparable to that found in tomato [2,7] and eggplant [1].
Figure 2

RT-PCR analysis of flower buds from strawberry and raspberry plants transgenic for the DefH9-iaaM gene. Analysis was performed with single strand cDNA synthesized from mRNA extracted from young flower buds of: control and transgenic F. vesca plants (panel a, lane 1: untrasformed plants; lanes 2 and 3: transgenic lines 1 and 2, respectively); control and transgenic F. x ananassa plants (panel b, lane 1: mock reaction without template; lane 2: untransformed plant: lane 3; transgenic line 1); control and transgenic R. idaeus (panel a, lane 4: untransformed plants, lane 5: transgenic line 1). The resulting 149 bp amplicon corresponds to the 5'end portion of the DefH9-iaaM mRNA.

The DefH9-iaaM gene is biochemically and biologically active in flower buds of strawberry and raspberry

The DefH9-iaaM gene product is known to cause parthenocarpy in Solanaceae by converting tryptophan to indole-3-acetamide which is then hydrolysed to IAA. Thus, to establish whether the DefH9-iaaM gene has a similar biological function in Rosaceae we have evaluated fruit development in emasculated flowers of the transgenic lines. To confirm that it is biochemically active we have measured the total IAA content of fruit. This value includes both free IAA and IAA produced by the hydrolysis of IAM and conjugated IAA. In emasculated flowers, the presence of the DefH9-iaaM gene in the genome of both F. vesca and F. x ananassa plants caused parthenocarpic development of the achenes and some swelling of the receptacle (Fig. 3, panels a-d). All emasculated flowers of DefH9-iaaM F. vesca plants were able to sustain achene development (Fig. 3, panel a), whilst 80% (24 out of 30) of emasculated flowers in control plants did not develop achenes (Fig. 3, panel b). A similar result was found in F. x ananassa (Fig. 3, panels c and d), where 28 out of 30 DefH9-iaaM emasculated flowers developed achenes, whereas only 4 out of 30 emasculated control flowers developed achenes. Raspberry plants transgenic for the DefH9-iaaM gene showed parthenocarpic fruit development from emasculated flowers (Fig. 3, panels e and f). Twenty-seven out of 30 emasculated flowers from DefH9-iaaM raspberry plants developed fruits, whereas only 3 out of 30 emasculated flowers of control plants showed fruit development. Thus, in three species belonging to Rosaceae, the DefH9-iaaM gene conferred parthenocarpic fruit development to emasculated flowers. However, the commercial fruits obtained from emasculated flowers of both strawberry (i.e. receptacle) and raspberry did not develop fully. In all three species, the percentage fruit-set of self-pollinated flowers, both transgenic and control, was 100% (data not shown).
Figure 3

Parthenocarpy in strawberry and raspberry transgenic for the DefH9-iaaM gene. Parthenocarpic development of the achene in emasculated flowers of F. vesca and F. x ananassa transgenic for the DefH9-iaaM gene (panel a and c) in comparison with emasculated flowers from control plants (panels b and d). Parthenocarpic development of raspberry drupelets in emasculated flowers of DefH9-iaaM raspberry plants (panel e), in comparison with emasculated flowers from control plants (panel f). Pictures were taken, for F. vesca 21 days after emasculation, and for F. x ananassa and raspberry 30 days after emasculation.

The total auxin (IAA) content of young flower buds of strawberry (wild and cultivated) and raspberry plants was analysed by GC-MS. Flower buds transgenic for the DefH9-iaaM gene had an IAA content higher than controls. In F. vesca, IAA content after hydrolysis was 40.1 and 24.4 picomoles/gram fresh weight in DefH9-iaaM (line 2) and control flower buds, respectively. In F. x ananassa, DefH9-iaaM young flower buds contained 446 picomoles of IAA per gram fresh weight, while flower buds from control untransformed plants contained 301 picomoles/gram of fresh weight. In R. idaeus, transgenic flower buds contained 89.4 picomoles/gram fresh weight while untransformed flower buds contained 12.8 picomoles/gram fresh weight. Thus, in DefH9-iaaM transgenic flower buds of all three species, the total IAA content was increased in comparison to untransformed controls. From the aforementioned results, we conclude that the DefH9-iaaM gene is biologically and biochemically active in the flower buds of plants belonging to the Rosaceae.

DefH9-iaaM strawberry and raspberry fruits have increased weight and size

Under standard cultivation conditions, i.e. allowing pollination and fertilization, the DefH9-iaaM gene increases both weight and size of the receptacle, which is equivalent to the "commercial" strawberry fruit (Fig. 4, panel a; Table 1). The weight of strawberry fruits from DefH9-iaaM F. vesca plants was significantly higher and was increased by an average of 24% (18% and 30% increased in line 1 and line 2, respectively) in comparison to control fruits (Table 1). The increase in weight of DefH9-iaaM F. vesca fruits correlated with an increase in fruit size (fruit height and diameter; Fig. 4, panel a; Table 1). For cultivated strawberry (F. x ananassa), the average fruit weight was increased by 62% in DefH9-iaaM plants (Fig. 4, panel b; Table 1). The presence of the DefH9-iaaM gene did not modify the total sugar content of transgenic strawberry fruits compared to control fruits (Table 1). DefH9-iaaM raspberry fruits were 14% heavier than control fruits (Table 1) and the increase in fruit weight correlated with an increase in fruit size (Fig. 4, panel c; Table 1). DefH9-iaaM raspberry fruits had a total sugar content that was not significantly different from that of fruits from control plants (Table 1).
Figure 4

Strawberry and raspberry fruits from control and DefH9-iaaM plants. Wild strawberry F. vesca fruits (panel a): control plant, fruits in the top row; DefH9-iaaM line 1, fruits in the middle row; DefH9-iaaM line 2, fruits in the bottom row. Cultivated strawberry F. x ananassa (panel b): control plant (left fruit) and DefH9-iaaM (right fruit). Raspberry R. idaeus fruits (panel c): control plant (the three fruits in the bottom row) and DefH9-iaaM (the three fruits in the top row). Annotation: C = untransformed control; L = transgenic line.

Table 1

Fruit parameters: size (average height and average diameter), weight, total sugar content from control and DefH9-iaaM transgenic lines of strawberry (F. vesca and F. x ananassa) cultivated in greenhouse and raspberry (R. idaeus) cultivated in open field.

Fruit sizeFruit weightTotal Sugar
LinesHeight (mm)Diameter (mm)g°Brix

F. vesca – greenhouse

Control11.90 ± 0.09 c11.69 ± 0.44 c0.76 ± 0.01 c11.46 ± 0.54 a
DefH9-iaaM 113.14 ± 0.10 b13.05 ± 0.47 b0.90 ± 0.01 b11.72 ± 0.41 a
DefH9-iaaM 213.99 ± 0.10 a13.81 ± 0.47 a0.99 ± 0.02 a11.34 ± 0.49 a

F. x ananassa – greenhouse

Control30.77 ± 0.91 b23.77 ± 0.77 b7.76 ± 0.69 b7,87 ± 0.12 a
DefH9-iaaM 137.55 ± 1.02 a29.11 ± 0.69 a12.55 ± 0.78 a7,91 ± 0.15 a

R. idaeus – open field

Control19.82 ± 1.12 b21.80 ± 1.10 b2.19 ± 0.05 b11.73 ± 0.18 a
DefH9-iaaM 121.89 ± 1.30 a24.30 ± 1.11 a2.50 ± 0.07 a13.50 ± 0.13 a

Values are means ± SE calculated on at least 30 fruits for each production cycle (see methods for details). For each trait, means followed by at least one common letter are not significantly different according to Duncan's Multiple Range Test (p < 0.01). SE = Standard Error.

DefH9-iaaM strawberry and raspberry plants have an increased number of fruits per inflorescence and an increased number of inflorescences per plant

DefH9-iaaM strawberry plants developed more fruits per inflorescence (Table 2). Inflorescences of DefH9-iaaM F. vesca plants developed 45% more fruits per inflorescence, while DefH9-iaaM F. x ananassa plants developed 18% more fruits per inflorescence than control plants. DefH9-iaaM raspberry inflorescences developed 47% more fruits per inflorescence (fruiting lateral) than controls (Table 2)
Table 2

Plant fecundity and fruit yield: number of inflorescences per plant/strawberry – cane/raspberry, number of fruits per inflorescence and total plant (strawberry) – cane (raspberry) fruit production from control and DefH9-iaaM transgenic lines of strawberry (F. vesca and F. x ananassa) cultivated in greenhouse and raspberry (R. idaeus) cultivated in open field.

LinesInflorescence per plant/caneFruit per inflorescenceFruit Production g/plant – cane
F. vesca – greenhouse

Control8.43 ± 0.79 b2,41 ± 0.07 b15.55 ± 1.28 c
DefH9-iaaM 110.71 ± 0.68 ab3.44 ± 0.09 a32.94 ± 1.62 b
DefH9-iaaM 211.94 ± 0.65 a3.53 ± 0.09 a41.32 ± 2.64 a

F. x ananassa – greenhouse

Control4.12 ± 0.66 b4.27 ± 0.33 b135.13 ± 12.48 b
DefH9-iaaM 16.15 ± 0.47 a5.03 ± 0.35 a383.36 ± 36.56 a

R. idaeus – open field

Control9.43 ± 0.37 b9.50 ± 0.52 b195.76 ± 17.29 b
DefH9-iaaM 111.50 ± 0.45 a13.96 ± 0.56 a408.53 ± 34.94 a

Values are means ± SE collected from 15 plants of F. vesca, 15 plants of F. x ananassa. For raspberry, four plants from each of the four plots were analysed, and five canes per plant were evaluated (see methods for details). For each trait, means followed by at least one common letter are not significantly different according to Duncan's Multiple Range Test (p < 0.01). SE = Standard Error.

DefH9-iaaM strawberry plants also developed a larger number of inflorescences per plant compared to untransformed control plants (Table 2). DefH9-iaaM F. vesca plant line 2 had an average of 42% more inflorescences per plant (Table 2). DefH9-iaaM F. vesca plant line 1 showed a 27% increase in the number of inflorescences, although the increase observed in line 1 compared to controls was not statistically significant (Table 2). DefH9-iaaM F. x ananassa plants developed 49% more inflorescences than control plants (Table 2). DefH9-iaaM raspberry plantshad an average of 22% more inflorescence (fruiting laterals) per cane (Table 2). The data for F. vesca relating to fruit weight and size, number of fruits per inflorescence, and number of inflorescences per plant result from trials over three harvesting seasons (i.e. 2000, 2001 and 2002) under greenhouse cultivation conditions. The F. x ananassa data were collected during one harvesting season (2003) under greenhouse cultivation conditions. The raspberry data on fruit weight, fruit size and plant fecundity derive from trials over two harvesting seasons (2002 and 2003). Raspberry plants were cultivated under open field conditions.

DefH9-iaaM strawberry and raspberry plants show increased fruit productivity

Fruit production of F. vesca, an ever-bearing strawberry, was evaluated under greenhouse cultivation conditions for three consecutive years (i.e. 2000, 2001 and 2002; see methods). Each harvesting period was five weeks long (Table 2). The increase in fruit production of DefH9-iaaM wild strawberry averaged 139% (112% in line 1 and 166% in line 2). Fruit production of F. x ananassa was evaluated during one year of cultivation under greenhouse conditions. The increase in fruit production of DefH9-iaaM cultivated strawberry was 184% (Table 2). DefH9-iaaM raspberry plants were evaluated under open field cultivation conditions and the data were obtained from two five-week harvesting seasons (i.e. 2002 and 2003). DefH9-iaaM raspberry plants showed, on the average, a 108% increase in fruit production (Table 2). In all three species, the highly significant increase in fruit productivity resulted from an increase in all three parameters relevant to fruit productivity, namely; number of inflorescences per plant, number of fruits per inflorescence, fruit weight (Tables 1 and 2). We wish to stress that environmental and cultivation conditions allowed pollination and fertilization. Fruits bore seeds. Thus, the productivity data are based on fruits that are not parthenocarpic.

Discussion

In the present work, the effects caused on fruit production by the DefH9-iaaM gene in three plant species belonging to the Rosaceae and bearing fruits of different types have been analyzed. In the two strawberry species tested (F. vesca and F. x ananassa), the DefH9-iaaM gene that is expressed specifically in placenta and ovules [1] promotes parthenocarpic development of the achenes, in emasculated flowers. Similarly, DefH9-iaaM raspberry plants show, in emasculated flowers, parthenocarpic development of their fruit. Thus, consistent with results obtained in other species, e.g. eggplant, tomato, tobacco [6], the DefH9-iaaM gene also promotes parthenocarpy in Rosaceae. However, pathenocarpic fruits (i.e. from emasculated flowers) did not develop fully. As previously observed in tomato [7] and consistent with the biochemical function of the DefH9-iaaM gene [13], strawberry and raspberry flower buds transgenic for DefH9-iaaM showed increased total auxin (IAA) contents. In strawberry, the commercial fruit is the receptacle. Thus, despite its biological interest, achene parthenocarpy is not of biotechnological significance in strawberry. Increased production of strawberry fruit (i.e. the receptacles) does have an applied interest. Auxin synthesized by the fertilized ovules is known to sustain the growth of strawberry fruit (receptacles) [9]. Thus, the increased auxin synthesis of DefH9-iaaM flower buds might promote the growth of strawberry fruit. We have shown that, under standard cultivation conditions, i.e. allowing pollination/fertilization, the DefH9-iaaM gene improves fruit growth and production in both species of strawberry tested. The weight of DefH9-iaaM wild strawberry (F. vesca) fruits was increased by the average of 24%, while the weight of DefH9-iaaM cultivated strawberry (F. x ananassa) fruits increased by 62%. Thus, in strawberry plants cultivated under standard conditions, and consequently under conditions allowing pollination/fertilization, the DefH9-iaaM gene improved fruit growth in comparison to control untransformed plants. The increase in weight and size of DefH9-iaaM strawberry fruits is consistent with a role of auxin in sustaining fruit growth [10,14]. In strawberry, exogenous auxin is known to replace fertilized ovules in stimulating the growth of the receptacle, but inhibits fruit ripening [15]. We did not observe any effects of the DefH9-iaaM auxin-synthesizing gene on strawberry fruit ripening, however. DefH9-iaaM strawberry plants also developed more inflorescences per plant (34% and 49% more in wild and cultivated strawberry, respectively) and more flowers/fruits per inflorescence (45% and 18% more in wild and cultivated strawberry, respectively). The increased fruit weight, the increased number of fruits per inflorescence, and the increased number of inflorescences per plant resulted in a significant net increase (i.e. more than 100% increase) in strawberry fruit production. In raspberry, the weight of DefH9-iaaM fruits was increased by 14% in comparison to control, non-transgenic fruits. In raspberry the presence of the DefH9-iaaM gene also caused an increase in the number of inflorescences per plant (22%) and in the number of flowers/fruits per inflorescence (47%). The overall effect of the DefH9-iaaM gene doubled (+108%) the yield of raspberry fruit. The sugar content of the fruit was not altered by the presence of the DefH9-iaaM gene in any of the three species tested in the present study. As already observed in other plant species analyzed (e.g. eggplant [1], tomato [2], tobacco [1], grape [16]), the DefH9-iaaM gene did not affect the vegetative growth of strawberry and raspberry plants compared to controls. The data obtained with these three perennial plants show that the DefH9-iaaM gene can be used, under standard cultivation conditions allowing pollination and fertilization, to improve fruit yield in plants belonging to the Rosaceae (e.g. strawberry and raspberry). Moreover, the novel finding that the presence of the DefH9-iaaM gene construct causes an increase in plant fecundity (i.e. number of flowers/fruits per inflorescence and number of inflorescences per plant) indicates that auxin has a role in plant fecundity in at least three Rosaceae. Since this seems to be a novel role of auxin, it needs to be further analysed in these and other plant species.

Conclusions

The data from strawberry (wild and cultivated) and raspberry plants transgenic for the DefH9-iaaM gene show that the DefH9-iaaM gene can be used, under standard cultivation conditions, to greatly improve fruit yield in perennial plants belonging to the Rosaceae. The fruits produced are not parthenocarpic, they do bear seeds. Consequently, the increased fruit yield is caused by an increased plant fecundity and an enhanced fruit growth. The novel finding that the presence of the DefH9-iaaM auxin-synthesizing gene causes an increase in plant fecundity (i.e. increased number of flowers/fruits per inflorescence and increased number of inflorescences per plant) indicates that, at least in these three perennial plants, auxin plays a role in plant fecundity. We wish to stress that an increase in plant fecundity has never been observed in any of the varieties of tomato and eggplant tested to date [6,7]. Thus, experiments using plants with novel genetic backgrounds are in progress to evaluate further the fecundity of DefH9-iaaM plants belonging to Solanaceae and Vitaceae [16].

Methods

Plant material and genetic transformation

In vitro proliferating shoots of the diploid strawberry (Fragaria vesca) cultivar Alpina W. Original, of the octaploid strawberry (Fragaria x ananassa) breeding selection AN93.231.53, and of the raspberry (Rubus idaeus) cultivar 'Ruby' were used for the experiments of genetic transformation. Regeneration protocols have been previously described [17]. The DefH9-iaaM gene has been previously described [1]. The nptII gene under the control of the nopaline synthase promoter, which is linked in the T-DNA to the DefH9-iaaM gene and confers resistance to the antibiotic kanamycin, was used as selectable marker. The Agrobacterium-mediated transformation protocol described by James et. al. [18] was used for all three species. After selection in vitro, regenerants were isolated and transferred to rooting medium (hormone-free MS medium for strawberry and MS supplemented with 0.5 mg/l IBA for raspberry) supplemented with 50 mg/l of kanamycin. Putative transgenic clones were acclimatized and characterized by Southern blot analysis.

Southern blot analysis

Genomic DNA was extracted from 1 g of frozen leaves using Nucleon PhytoPure system (Amersham Pharmacia) according to the manufacturer's instructions. 10 μg of DNA from each plant were digested with HindIII. The DNA was separated by electrophoresis through a 0.7% agarose gel at 4.5 V cm-1 and transferred to a nylon membrane (Hybond N, Amersham). The membrane was hybridized with 100 ng of fluorescein-labeled probe prepared using the Amersham "Random prime labeling module" kit. Detection was performed with anti-fluorescein AP conjugate (Amersham) and the chemiluminescent alkaline phosphatase CDP-Star substrate (Amersham) according to the manufacturer's instructions. The membranes were exposed for 1 h using Kodak XAR-5 films.

RT-PCR analysis

Flower buds (0.5 cm long) were frozen in liquid nitrogen. Total RNA was extracted by using NucleonPhytopure (Amershan) system, modified by adding Polyclar AT (95 mg/g of fresh tissue) and Na2S2O5 (0.4 %) during homogenization, and recovered after LiCl precipitation. PolyA+RNA was isolated from total RNA using oligo d(T) Dynabeads (Dynal) following the manufacturer's protocol. The amount of mRNA extracted was determined spectrophotometrically. RT-PCR analysis was carried out using as template 30 ng of first strand cDNA primed with an oligonucleotide starting 305 b downstream the AUG initiation codon of the iaaM gene, on mRNA extracted from flower buds. The cDNA was first amplified using the 5' primer (5'-TTTCCGAACAAGACAGGTTATTTTT-3') and the 3' primer (5'-ACTATCGCTACCCGAGGGGTGGGC-3'). The resulting amplicon spans parts of the untranslated leader and coding region of the DefH9-iaaM gene. An aliquot of the first PCR was diluted and re-amplified with the following nested primers: 5' primer 5'-CCAAAGAATCGTAATCCGGGTAGCACG-3' and 3'primer 5'-AATAGCTGCCTATGCCTCCCGTCAT-3'. The 149 bp amplicon resulting from the nested PCR reaction was checked by DNA sequencing (data not shown). Real-time PCR was performed by using Gene Amp 5700 system (PE Applied Biosystem). A 600 bp long DefH9 cDNA fragment was used as standard in the Real-time PCR experiments. The expression level was estimated as ratio between transgene mRNA and total mRNA used as template in the RT-PCR reaction.

IAA analysis

Samples (flower buds) were ground to a fine powder and extracted with 80% methanol/water (v/v) containing 1 μM buthylate hydroxytoluene (Sigma) overnight at 4°C. The extracts were centrifuged for 15 min at 4°C and dried under N2. 100 nmol of indole propionic acid were added to the acqueous solutions, as internal standard. The hydrolysis of amidic and esteric IAA conjugated were carried out in 3 M NaOH at 37°C for 3 h. The pH of samples was adjusted to 9 by adding 2 M HCl, and extraction was performed with 2 ml of ethylacetate for 30 min. The aqueous phases were extracted and partitioned against ethylacetate and the pH adjusted to 2.5. The samples were then extracted twice with diethylether for 30 min and dried under N2. The samples were then dissolved in 100 μl of acetonitrile and 200 μl of N, O-bis.(trimethylsilyl) trifluoroacetamide (BSTFA, Pierce) were added to each sample for 30 min at 50°C. The samples were then dried under N2, dissolved in 20 μl of hexane. Aliquots (1 μl) were analysed by GC-MS. The TMS GC-MS analysis was performed on Hewlett Packard 5890 instrument by using a HP-5 (Agilent technologies) fused silica capillary column (30 m, 0.25 mm ID, Helium as carrier gas), with the temperature programme: 70°C for 1 min, 70°C→150°C at 20°C/min, 150°C→200°C at 10°C/min, 200°C→280°C at 30°C/min, 280°C for 15 min. The injection temperature was 280°C. Electron Ionisation (EI) mass spectra were recorded by continuous quadrupole scanning at 70 eV ionisation energy.

Phenotypic analysis

In all three species, DefH9-iaaM and control plants were propagated by standard propagation techniques and transferred either to the greenhouse or to open field for the analysis of vegetative and reproductive plant growth. Plants of F. vesca were cultivated under greenhouse conditions in single pots (20 cm diameter/18 cm height) and analyzed for three consecutive years (i.e. 2000, 2001 and 2002). The first two production cycles were performed with F. vesca plants just acclimatized. The F. vesca plants analyzed in the third cycle (i.e. 2002) had been acclimatized the previous year, and consequently the third cycle of production refers to strawberry plants in the second year of growth. To monitor the biological effects caused by the DefH9iaaM gene in cultivated strawberry (F. x ananassa), one cultivation/production cycle (i.e. 2003) was performed, under greenhouse conditions, using plants vegetatively propagated in vivo by runners and grown in single pots (24 cm diameter/22 cm height). In all experiments, 15 strawberry plants were used for each line. Raspberry plants were analyzed under open field conditions for two consecutive years (i.e. 2002 and 2003). The plants were propagated in vitro, acclimatized in the greenhouse in single pots (24 cm diameter/22 cm height) and then transferred in the open field in 2001. Forty plants transgenic for the DefH9-iaaM gene and forty plants of control line were arranged in four plots, each one consisting of ten plants. Fruit productivity in two consecutive years (i.e. 2002 and 2003) was evaluated by harvesting the fruits produced during five weeks from canes originating from the same plant pruned in late winter (February) and thinned before blossoming (on average 10 canes per linear meter). Greenhouse and open field experiments were carried out at the Experimental Farm of the Marche Polytechnic University. To evaluate plant fecundity and fruit yield of DefH9-iaaM F. vesca plants, the number of fruits per inflorescence, number of inflorescences per plant and fruit production were recorded during the harvest period corresponding to five weeks of each production cycle (i.e. each year for three years). For cultivated strawberry (F. x ananassa), these parameters were recorded during the entire production cycle (one year). In raspberry, for each year of cultivation (i.e. two years), the number of inflorescences per cane, the number of fruits per inflorescence, and fruit production were measured on a total of 160 randomly-chosen canes (5 canes from 4 plants from each plot; i.e. 20 canes per plot every year) for DefH9-iaaM and control line. Fruits were harvested for five weeks in order to evaluate fruit production. In F. vesca, the average fruit weight, fruit size parameters (average fruit basal diameter and fruit height) were measured on 30 fruits for each year and line. Total sugar content (°Brix) was measured on three extracts, each one obtained from 10 fruits. The fruits were sampled randomly from the fruits harvested during the second and third week of harvest of every year of cultivation. For Fragaria x ananassa, the fruit weight and size data were obtained from 50 fruits collected during the second week of harvest (the whole harvest lasted three weeks). °Brix was evaluated on two extracts, each one obtained from 25 fruits. From each extract, two measurements were made. For raspberry, the fruit weight and size data were obtained from 40 fruits sampled randomly from the fruits harvested during the second and third week of harvest of every year of cultivation. °Brix was evaluated, each year of cultivation, on two extracts each one obtained from 20 fruits. Two measurements were made of each extract. Data were subjected to one-way ANOVA for means comparison, and significant differences were calculated according to Duncan's Multiple Range Test, P < 0.01. Parthenocarpy was monitored by evaluating fruit set in emasculated flowers from transgenic and control untransformed plants. Flower buds (30 flower buds/line) from transgenic and control plants of both wild and cultivated strawberry were emasculated before dehiscence of anthers (closed flowers) and covered with a small paper bag until achene formation and receptacle development. The same technique was used to evaluate the formation of aggregated drupelets in emasculated raspberry flowers.

Authors' contributions

BM performed and supervised plant transformation, plant propagation and plant evaluation. LL performed plant transformation, plant propagation and plant evaluation. TP performed the molecular analysis of transgenic plants. AS coordinated the project and drafted the manuscript. All authors have read and approved the final manuscript.
  5 in total

1.  Microbial synthesis and degradation of indole-3-acetic acid. I. The conversion of L-tryptophan to indole-3-acetamide by an enzyme system from Pseudomonas savastanoi.

Authors:  T Kosuge; M G Heskett; E E Wilson
Journal:  J Biol Chem       Date:  1966-08-25       Impact factor: 5.157

2.  Genetic engineering of parthenocarpic plants.

Authors:  G L Rotino; E Perri; M Zottini; H Sommer; A Spena
Journal:  Nat Biotechnol       Date:  1997-12       Impact factor: 54.908

3.  Genetically modified parthenocarpic eggplants: improved fruit productivity under both greenhouse and open field cultivation.

Authors:  Nazzareno Acciarri; Federico Restaino; Gabriele Vitelli; Domenico Perrone; Michela Zottini; Tiziana Pandolfini; Angelo Spena; Giuseppe Rotino
Journal:  BMC Biotechnol       Date:  2002-04-04       Impact factor: 2.563

4.  Optimisation of transgene action at the post-transcriptional level: high quality parthenocarpic fruits in industrial tomatoes.

Authors:  Tiziana Pandolfini; Giuseppe L Rotino; Serena Camerini; Roberto Defez; Angelo Spena
Journal:  BMC Biotechnol       Date:  2002-01-11       Impact factor: 2.563

5.  Genetic transformation of Vitis vinifera via organogenesis.

Authors:  Bruno Mezzetti; Tiziana Pandolfini; Oriano Navacchi; Lucia Landi
Journal:  BMC Biotechnol       Date:  2002-09-27       Impact factor: 2.563

  5 in total
  37 in total

Review 1.  Distinct and dynamic auxin activities during reproductive development.

Authors:  Eva Sundberg; Lars Østergaard
Journal:  Cold Spring Harb Perspect Biol       Date:  2009-10-14       Impact factor: 10.005

2.  Two homologous INDOLE-3-ACETAMIDE (IAM) HYDROLASE genes are required for the auxin effects of IAM in Arabidopsis.

Authors:  Yangbin Gao; Xinhua Dai; Yuki Aoi; Yumiko Takebayashi; Liping Yang; Xiaorui Guo; Qiwei Zeng; Hanchuanzhi Yu; Hiroyuki Kasahara; Yunde Zhao
Journal:  J Genet Genomics       Date:  2020-03-19       Impact factor: 4.275

3.  Auxin synthesis-encoding transgene enhances grape fecundity.

Authors:  Elisa Costantini; Lucia Landi; Oriana Silvestroni; Tiziana Pandolfini; Angelo Spena; Bruno Mezzetti
Journal:  Plant Physiol       Date:  2007-03-02       Impact factor: 8.340

4.  Genome-scale transcriptomic insights into early-stage fruit development in woodland strawberry Fragaria vesca.

Authors:  Chunying Kang; Omar Darwish; Aviva Geretz; Rachel Shahan; Nadim Alkharouf; Zhongchi Liu
Journal:  Plant Cell       Date:  2013-06-28       Impact factor: 11.277

5.  SmARF8, a transcription factor involved in parthenocarpy in eggplant.

Authors:  Liming Du; Chonglai Bao; Tianhua Hu; Qinmei Zhu; Haijiao Hu; Qunyan He; Weihai Mao
Journal:  Mol Genet Genomics       Date:  2015-07-15       Impact factor: 3.291

6.  Auxin boost for cotton.

Authors:  Z Jeffrey Chen; Xueying Guan
Journal:  Nat Biotechnol       Date:  2011-05       Impact factor: 54.908

Review 7.  Unraveling the signal scenario of fruit set.

Authors:  Mariana Sotelo-Silveira; Nayelli Marsch-Martínez; Stefan de Folter
Journal:  Planta       Date:  2014-06       Impact factor: 4.116

8.  Expression of aberrant forms of AUXIN RESPONSE FACTOR8 stimulates parthenocarpy in Arabidopsis and tomato.

Authors:  Marc Goetz; Lauren C Hooper; Susan D Johnson; Julio Carlyle Macedo Rodrigues; Adam Vivian-Smith; Anna M Koltunow
Journal:  Plant Physiol       Date:  2007-08-31       Impact factor: 8.340

9.  Fruit growth in Arabidopsis occurs via DELLA-dependent and DELLA-independent gibberellin responses.

Authors:  Sara Fuentes; Karin Ljung; Karim Sorefan; Elizabeth Alvey; Nicholas P Harberd; Lars Østergaard
Journal:  Plant Cell       Date:  2012-10-12       Impact factor: 11.277

10.  Generation and analysis of ESTs from strawberry (Fragaria xananassa) fruits and evaluation of their utility in genetic and molecular studies.

Authors:  Aureliano Bombarely; Catharina Merchante; Fabiana Csukasi; Eduardo Cruz-Rus; José L Caballero; Nieves Medina-Escobar; Rosario Blanco-Portales; Miguel A Botella; Juan Muñoz-Blanco; José F Sánchez-Sevilla; Victoriano Valpuesta
Journal:  BMC Genomics       Date:  2010-09-17       Impact factor: 3.969

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.