Literature DB >> 15113396

First isolation and further characterization of enteropathogenic Escherichia coli (EPEC) O157:H45 strains from cattle.

Roger Stephan1, Nicole Borel, Claudio Zweifel, Miguel Blanco, Jesús E Blanco.   

Abstract

BACKGROUND: Enteropathogenic Escherichia coli (EPEC), mainly causing infantile diarrhoea, represents one of at least six different categories of diarrheagenic E. coli with corresponding distinct pathogenic schemes. The mechanism of EPEC pathogenesis is based on the ability to introduce the attaching-and-effacing (A/E) lesions and intimate adherence of bacteria to the intestinal epithelium. The role and the epidemiology of non-traditional enteropathogenic E. coli serogroup strains are not well established. E. coli O157:H45 EPEC strains, however, are described in association with enterocolitis and sporadic diarrhea in human. Moreover, a large outbreak associated with E. coli O157:H45 EPEC was reported in Japan in 1998. During a previous study on the prevalence of E. coli O157 in healthy cattle in Switzerland, E. coli O157:H45 strains originating from 6 fattening cattle and 5 cows were isolated. In this study, phenotypic and genotypic characteristics of these strains are described. Various virulence factors (stx, eae, ehxA, astA, EAF plasmid, bfp) of different categories of pathogenic E. coli were screened by different PCR systems. Moreover, the capability of the strains to adhere to cells was tested on tissue culture cells.
RESULTS: All 11 sorbitol-positive E. coli O157:H45 strains tested negative for the Shiga toxin genes (stx), but were positive for eae and were therefore considered as EPEC. All strains harbored eae subtype alpha1. The gene encoding the heat-stable enterotoxin 1 (EAST1) was found in 10 of the 11 strains. None of the strains, however, carried ehx A genes. The capability of the strains to adhere to cells was shown by 10 strains harbouring bfp gene by localized adherence pattern on HEp-2 and Caco-2 cells.
CONCLUSION: This study reports the first isolation of typical O157:H45 EPEC strains from cattle. Furthermore, our findings emphasize the fact that E. coli with the O157 antigen are not always STEC but may belong to other pathotypes. Cattle seem also to be a reservoir of O157:H45 EPEC strains, which are described in association with human diseases. Therefore, these strains appear to play a role as food borne pathogens and have to be considered and evaluated in view of food safety aspects.

Entities:  

Mesh:

Year:  2004        PMID: 15113396      PMCID: PMC394320          DOI: 10.1186/1471-2180-4-10

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Enteropathogenic Escherichia coli (EPEC), mainly causing infantile diarrhoea, represents one of the at least six different categories of diarrheagenic E. coli with corresponding distinct pathogenic schemes [1]. Most of the EPEC strains belong to a series of O antigenic groups known as EPEC O serogroups: O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142 and O158. The main mechanism of EPEC pathogenesis is the ability to introduce attaching-and-effacing (A/E) lesions on intestinal cells characterized by microvillus destruction, intimate adherence of strains to the intestinal epithelium, pedestal formation and aggregation of polarized actin at sites of bacterial attachment [2]. The genetic determinants for the production of A/E lesions are located on the locus of enterocyte effacement (LEE), a pathogenicity island that contains the genes encoding intimin (eae), a type III secretion system, a number of secreted proteins (ESP) and the translocated intimin receptor (Tir) [2]. Characterization of eae genes revealed the existence of different eae variants. At present, 15 (α1, α2, β1, β2, γ1, γ2/θ, δ/κ, ε, ζ, η, ι, λ, μ, ν, ξ) genetic variants of the eae gene have been identified [3-7]. It is discussed that different intimins may be responsible for different host- and tissue cell tropism [8,9]. In epithelial culture cells EPEC strains produce characteristic adherence patterns: (i) localized adherence (LA), where microcolonies attach after 3 hours incubation to one or two small areas on the cells [10,11]; (ii) diffuse adherence (DA), where bacteria cover the cells uniformly [10]; (iii) enteroadherent-aggregative adherence (AA), where the bacteria have a characteristic stacked-brick-like arrangement [12] and (iiii) localized adherence-like adherence (LAL), characterized by formation of less-compact microcolonies or clusters of bacteria than those by LA [13]. Localized adherence is associated with the presence of the large EPEC adherence factor (EAF) plasmid, on which also the cluster of genes encoding bundle-forming pili (BFP) is present [1]. EPEC are classified as typical, when possessing the EAF plasmid; whereas atypical EPEC strains do not possess the EAF plasmid [14,15]. Typical and atypical EPEC strains usually belong to certain serotype clusters, differ in their adherence patterns on cultured epithelial cells (typical: LA; atypical: DA; AA; LAL), are typically found in different hosts (typical EPEC strains have only been recovered from humans), and display difference in their intimin types [15]. The role and the epidemiology of non-traditional enteropathogenic E. coli serogroup strains in human diarrhea are not well established. E. coli O157:H8 and E. coli O157:H45 EPEC strains have been described to be associated with diarrhea in human [4,16]. Makino et al. [17] reported the first large outbreak with E. coli O157:H45 EPEC in Japan in 1998. Nevertheless, these O157 EPEC strains are not well characterized. This study reports the first isolation of O157:H45 EPEC strains from cattle and phenotypic and genotypic characteristics of the isolated strains are described.

Results and discussion

All 11 sorbitol-positive E. coli O157:H45 strains, six strains isolated from fattening cattle and five strains isolated from cows tested negative for Shiga toxin genes (stx). The eae gene, which is strongly correlated to the attaching-and-effacing lesions, was present in all strains. Therefore, these strains are considered to be EPEC. Our findings emphasize the fact that E. coli with the O157 O antigen are not always STEC but may belong to other pathotypes. Further results of strain characterization are shown in Tab. 2.
Table 2

Characterization results of 11 sorbitol-fermenting O157:H45 EPEC strains isolated from cattle in Switzerland

No. of strainsLEE in selCIntimin typeEAF PlasmidbfpAdherence patternastAehx
9yesα1++LA+-
1yesα1-+LA+-
1yesα1--NA--

LA: localized adherence; NA: no adherence

In all tested strains, LEE was inserted in selC and thus these strains could be evolutionarily more akin to the EPEC 1 and EHEC 1 clones than to other clones [18]. Further characterization of the eae variants showed in all strains eae subtype α1. Oswald et al. [4] testing in their study the distribution of intimin types among different EPEC strains, found the same eae subtype in O157:H45 strains isolated from human with diarrhea. The gene encoding the heat-stable enterotoxin (EAST1), representing an additional determinant in the pathogenesis of E. coli diarrhea, was found in ten of the 11 strains. None of the strains, however, carried ehxA genes. Nine strains were positive for the EAF plasmid and 10 strains harbored the bfpA gene encoding bundlin, the structural subunit of the bundle-forming pilus expressed by typical EPEC strains. The EAF plasmid negative but bfpA positive strain may have a defect in the EAF region that does not interfere with the plasmid's function. All bfpA gene positive strains showed a localized adherence (LA) pattern, the penotpyical characteristic associated with the expression of bundle-forming pili and therefore seem to be a typical EPEC. For HEp-2 and Caco-2 cells similar results were obtained (Figure 1, 2). Caco-2 cells instead of Hela cells were used for adhesion assay and FAS test, because they represent a system close to the human intestinal cells. Furthermore, Vieira et al. [19] have shown that results obtained by Caco-2 cells are comparable to Hela cells.
Figure 1

Localized adherence (LA) pattern of the E. coli O157:H45 strain 1070/03 on HEp-2 cells. (a) 3 h assay, (b) 6 h assay

Figure 2

Localized adherence (LA) pattern of the E. coli O157:H45 strain 1070/03 on Caco-2 cells. (a) 3 h assay, (b) 6 h assay

10 of the 11 strains showed an A/E property with the fluorescent actin staining (FAS) test (Figure 3).
Figure 3

Actin fluorescence micrograph showing E. coli O157:H45 strain 1070/03-infected Caco-2 cells

According to Kaper [14] most of our O157:H45 strains have to be classified as typical EPEC strains, because they are possessing the EAF plasmid and are showing the localized adherence (LA) pattern. However, they are harboring astA genes, which is more common for atypical EPEC strains [15]. Further studies are needed to evaluate the role of such EPEC strains isolated from asymptomatic animals.

Conclusions

Cattle have not only to be considered as important asymptomatic carriers of O157 STEC but can also be a reservoir of O157 EPEC strains, which are described in association with human diseases. These strains appear to play a role as food borne pathogens and have to be considered in view of food safety aspects.

Methods

Origin of the E. coli strains

The strains characterized in this work were isolated during a recent study on prevalence of E. coli O157 in healthy cattle in Switzerland [20]. The study was based on investigations that were carried out within the last one and a half years (January 2002 – June 2003) in two EU-approved slaughterhouses. From 2,930 bovine fecal samples (1,183 calves, 1,201 fattening cattle and 546 cows), 11 sorbitol-fermenting E. coli O157:H45 strains (from 6 fattening cattle and 5 cows) were isolated. The determination of the O and H antigens was performed as previously described using all available O (O1 to O181) and H (H1 to H56) antisera [6].

Genotypic characterization of the O157:H45 strains

PCR for the detection of putative virulence genes were performed in a T3 thermocycler (Biometra, Germany). PCR reagents were purchased from PROMEGA (Madison, Wis.) and primers were synthesized by MICROSYNTH (Balgach, Switzerland). The 50-μl PCR mixtures normally consisted of 2 μl of bacterial suspension in 42 μl of double-distilled water, 5 μl of 10-fold-concentrated polymerase synthesis buffer containing 2.0 mM MgCl2, 200 μM (each) desoxynucleosid triphosphate (dNTP), 30 pmol of each primer and 2.5 U of Taq DNA polymerase. The PCR primers, target sequences and product sizes are listed in Table 1. Differences in the normal PCR mixture and cycling conditions for each PCR were previously described in the cited literature.
Table 1

Sequences and predicted lengths of PCR amplification products of oligonucleotide primers used

TargetPrimerOligonucleotide sequence (5'-3')SequenceProduct sizeReference
stxVT1ATTGAGCAAAATAATTTATAT GTG523 bp21
VT2TGATGATGGCAATTCAGTAT520 bp
eaeSK1CCCGAATTCCGCACAAGCATAAGC863 bp22
SK2CCCGGATCCGTCTCGCCAGTATTCG
eae-α1EAE-FBAAAACCGCGGAGATGACTTC820 bp7
EAE-ACACTCTTCGCATCTTGAGCT
eae-α2IH2498aFAGACCTTAGGTACATTAAGTAAGC517 bp7
IH2498aRTCCTGAGAAGAGGGTAATC
eae-β1EA-B1-FCGCCACTTAATGCCAGCG811 bp7
EAE-BCTTGATACACCTGATGACTGT
eae-β2EA-B2-FCCCGCCACTTAATCGCACGT807 bp7
EAE-BCTTGATACACCTGATGACTGT
eae-γ1EAE-FBAAAACCGCGGAGATGACTTC804 bp7
EAE-C1AGAACGCTGCTCACTAGATGTC
eae-γ2/θEAE-FBAAAACCGCGGAGATGACTTC808 bp7
EAE-C2CTGATATTTTATCAGCTTCA
eae-δ/κEAE-FBAAAACCGCGGAGATGACTTC833 bp7
EAE-DCTTGATACACCCGATGGTAAC
eaeEAE-FBAAAACCGCGGAGATGACTTC722 bp7
LP5AGCTCACTCGTAGATGACGGCAAGCG
eaeZ1GGTAAGCCGTTATCTGCC206 bp7
Z2ATAGCAAGTGGGGTGAAG
eaeEAE-FBAAAACCGCGGAGATGACTTC712 bp7
LP8TAGATGACGGTAAGCGAC
eaeEAE-FBAAAACCGCGGAGATGACTTC807 bp7
LP7TTTATCCTGCTCCGTTTGCT
eae68.4FCGGTCAGCCTGTGAAGGGC466 bp7
68.4RATAGATGCCTCTTCCGGTATT
eaeFV373FCAACGGTAAGTCTCAGACAC443 bp7
FV373RCATAATAAGCTTTTTGGCCTACC
eaeIH1229aFCACAGCTTACAATTGATAACA311 bp7
IH1229aRCTCACTATAAGTCATACGACT
eaeEAE-FBAAAACCGCGGAGATGACTTC468 bp7
B49RACCACCTTTAGCAGTCAATTTG
ehxAHlyA1GGTGCAGCAGAAAAAGTTGTAG1551 bp23
HlyA2TCTCGCCTGATAGTGTTTGGTA
astAEAST1CCA TCA ACA CAG TAT ATC CGA111 bp24
EAST2GGT CGC GAG TGA CGG CTT TGT
EAFEAF1CAG GGT AAA AGA AAG ATG ATA A397 bp25
EAF25TAT GGG GAC CAT GTA TTA TCA
bfpAEP1AAT GGT GCT TGC GCT TGC TGC326 bp26
EP2GCC GCT TTA TCC AAC CTG GTA
To verify whether LEE was inserted downstream of the selC locus, PCR reactions that amplify the junctions of this locus with the E. coli chromosome were performed according to Sperandio et al. [27]. Primers K255 (5'-GGTTGAGTCGATTGATCTCTGG-3') and K260 (5'-GAGCGAATATTCCGATATCTGGTT-3') were used for the right junction; K296 (5'-CATTCTGAAACAAACTGCTC-3') and K295 (5'-CGCCGATTTTTCTTAGCCCA-3') for the left junction, and K261 (5'-CCTGCAAATAAACACGGCGCAT-3') and K260 for the intact selC gene.

Adhesion assay and FAS test

E. coli colonies were characterized by the pattern of adherence to HEp-2 and Caco-2 cells as described by Karch et al. [28] with minor modifications. Briefly, HEp-2 and Caco-2 cells were grown for 48 h with 5% CO2 on sterilized coverslips (13 mm diameter; Bibby Sterilin™ Ltd., Stone, England) in 24-well flat-bottom tissue culture plates with low evaporation lid (16 mm diameter; BD Falcon™, Bedford, USA) containing Minimum essential medium (MEM with Earle's salts, 25 mM HEPES, without L-Glutamine;GIBCO™ Invitrogen AG, Basel, Switzerland) supplemented with fetal calf serum (FCS, 10%, Bio Concept™, Allschwil, Switzerland), MEM Non Essential Amino Acids (MEM NEAA (100x) without L-Glutamine, GIBCO™ Invitrogen AG, Basel, Switzerland) and GlutaMAX™I Supplement 200 mM (100x), (GIBCO™ Invitrogen AG, Basel, Switzerland). Bacteria used for the adhesion assay were grown over night in LB-broth Miller (Becton Dickinson, Maryland, USA). Prior to incubation, the confluent cells were washed two times with Dulbecco's phospate buffered saline (D-PBS (1x) without Calcium and Magnesium, GIBCO™ Invitrogen AG, Basel, Switzerland). E. coli diluted 1:100 in 1 ml fresh media (MEM with supplements) was added to the cells and was incubated for 3 h at 37°C and 5% CO2. After this incubation period, monolayers were washed five times with D-PBS (3 h assay) or monolayers were washed ten times with D-PBS, fresh media (MEM with supplements) was added and an additional incubation period of 3 h proceeded (6h assay). Subsequently, the monolayers were washed five times with D-PBS and the cells were fixed for 10 min with 4 Methanol. After the staining with May-Grünwald-Giemsa (Fluka™, Buchs SG, Switzerland), the coverslips were examined by light microscopy to determine the adherence patterns of the strains. The following fluorescent actin-staining (FAS) test was performed on Caco-2 cells according to Karch et al. [28] with minor modifications. The cells were fixed with 4% formaldehyde in D-PBS, then washed three times with D-PBS and incubated for 5 min with 0.1% Triton X-100 (Fluka™, Buchs SG, Switzerland) in D-PBS. After another three washes with D-PBS, the monolayers were incubated with 5 μg/ml of fluorescein isothiocyanate labelled phaloidin (Sigma, Steinheim, Germany) for 30 min. After another three washes with D-PBS, the coverslips were examined by fluorescence microscopy (Leica ™).

Authors' contributions

RS isolated the strains and drafted the manuscript, CZ was responsible for further strain characterization, NB performed adhesion assays and FAS tests, MB performed the PCR typing of eae genes and JE has done serotyping of the strains. All authors read, commented on and approved of the final manuscript.
  26 in total

1.  The type IV bundle-forming pilus of enteropathogenic Escherichia coli undergoes dramatic alterations in structure associated with bacterial adherence, aggregation and dispersal.

Authors:  S Knutton; R K Shaw; R P Anantha; M S Donnenberg; A A Zorgani
Journal:  Mol Microbiol       Date:  1999-08       Impact factor: 3.501

2.  Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain.

Authors:  M Blanco; J E Blanco; A Mora; J Rey; J M Alonso; M Hermoso; J Hermoso; M P Alonso; G Dahbi; E A González; M I Bernárdez; J Blanco
Journal:  J Clin Microbiol       Date:  2003-04       Impact factor: 5.948

3.  Description of a novel intimin variant (type zeta) in the bovine O84:NM verotoxin-producing Escherichia coli strain 537/89 and the diagnostic value of intimin typing.

Authors:  Joerg Jores; Karen Zehmke; Juergen Eichberg; Leonid Rumer; Lothar H Wieler
Journal:  Exp Biol Med (Maywood)       Date:  2003-04

4.  Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells.

Authors:  J P Nataro; J B Kaper; R Robins-Browne; V Prado; P Vial; M M Levine
Journal:  Pediatr Infect Dis J       Date:  1987-09       Impact factor: 2.129

5.  Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains.

Authors:  W L Zhang; B Köhler; E Oswald; L Beutin; H Karch; S Morabito; A Caprioli; S Suerbaum; H Schmidt
Journal:  J Clin Microbiol       Date:  2002-12       Impact factor: 5.948

6.  Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant.

Authors:  E Oswald; H Schmidt; S Morabito; H Karch; O Marchès; A Caprioli
Journal:  Infect Immun       Date:  2000-01       Impact factor: 3.441

7.  Fecal shedding of Escherichia coli O157, Salmonella, and Campylobacter in Swiss cattle at slaughter.

Authors:  H al-Saigh; C Zweifel; J Blanco; J E Blanco; M Blanco; M A Usera; R Stephan
Journal:  J Food Prot       Date:  2004-04       Impact factor: 2.077

8.  Distinctive patterns of adherence of enteropathogenic Escherichia coli to HeLa cells.

Authors:  I C Scaletsky; M L Silva; L R Trabulsi
Journal:  Infect Immun       Date:  1984-08       Impact factor: 3.441

9.  Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-xi).

Authors:  M Blanco; J E Blanco; A Mora; G Dahbi; M P Alonso; E A González; M I Bernárdez; J Blanco
Journal:  J Clin Microbiol       Date:  2004-02       Impact factor: 5.948

Review 10.  Typical and atypical enteropathogenic Escherichia coli.

Authors:  Luiz R Trabulsi; Rogéria Keller; Tânia A Tardelli Gomes
Journal:  Emerg Infect Dis       Date:  2002-05       Impact factor: 6.883

View more
  9 in total

1.  Molecular Characterization of Human Atypical Sorbitol-Fermenting Enteropathogenic Escherichia coli O157 Reveals High Diversity.

Authors:  Annelene Kossow; Wenlan Zhang; Martina Bielaszewska; Sophie Rhode; Kevin Hansen; Angelika Fruth; Christian Rüter; Helge Karch; Alexander Mellmann
Journal:  J Clin Microbiol       Date:  2016-03-16       Impact factor: 5.948

2.  Characterization of the pathogenome and phylogenomic classification of enteropathogenic Escherichia coli of the O157:non-H7 serotypes.

Authors:  Fatemeh Sanjar; Brigida Rusconi; Tracy H Hazen; Sara S K Koenig; Mark K Mammel; Peter C H Feng; David A Rasko; Mark Eppinger
Journal:  Pathog Dis       Date:  2015-05-10       Impact factor: 3.166

3.  Molecular evolution of typical enteropathogenic Escherichia coli: clonal analysis by multilocus sequence typing and virulence gene allelic profiling.

Authors:  David W Lacher; Hans Steinsland; T Eric Blank; Michael S Donnenberg; Thomas S Whittam
Journal:  J Bacteriol       Date:  2006-11-10       Impact factor: 3.490

4.  A novel epimerase that converts GlcNAc-P-P-undecaprenol to GalNAc-P-P-undecaprenol in Escherichia coli O157.

Authors:  Jeffrey S Rush; Cristina Alaimo; Riccardo Robbiani; Michael Wacker; Charles J Waechter
Journal:  J Biol Chem       Date:  2009-11-18       Impact factor: 5.157

5.  Trimebutine as a potential antimicrobial agent: a preliminary in vitro approach.

Authors:  J Kountouras; D Sofianou; E Gavalas; E Sianou; C Zavos; G Meletis; E Tsiaousi
Journal:  Hippokratia       Date:  2012-10       Impact factor: 0.471

6.  Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli.

Authors:  Atsushi Iguchi; Hiroki Shirai; Kazuko Seto; Tadasuke Ooka; Yoshitoshi Ogura; Tetsuya Hayashi; Kayo Osawa; Ro Osawa
Journal:  PLoS One       Date:  2011-08-18       Impact factor: 3.240

7.  Serotypes, intimin variants and other virulence factors of eae positive Escherichia coli strains isolated from healthy cattle in Switzerland. Identification of a new intimin variant gene (eae-eta2).

Authors:  Miguel Blanco; Sandra Schumacher; Taurai Tasara; Claudio Zweifel; Jesús E Blanco; Ghizlane Dahbi; Jorge Blanco; Roger Stephan
Journal:  BMC Microbiol       Date:  2005-05-09       Impact factor: 3.605

8.  Absolute quantification of E. coli virulence and housekeeping genes to determine pathogen loads in enumerated environmental samples.

Authors:  K B Hoorzook; T G Barnard
Journal:  PLoS One       Date:  2021-11-29       Impact factor: 3.240

9.  Draft Genome Sequences of Three O157 Enteropathogenic Escherichia coli Isolates.

Authors:  Tracy H Hazen; Jason W Sahl; Claire M Fraser; Michael S Donnenberg; Flemming Scheutz; David A Rasko
Journal:  Genome Announc       Date:  2013-07-18
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.