Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.