Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants.

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.