| Literature DB >> 14597159 |
Olga M Viquez1, Koffi N Konan, Hortense W Dodo.
Abstract
Peanut is one of the most allergenic foods. It contains multiple seed storage proteins identified as allergens, which are responsible for triggering IgE-mediated allergic reactions. Ara h 1 is a major peanut allergen recognized by over 90% of peanut sensitive population. The objectives of this study were to isolate, sequence, and determine the structure and organization of at least one genomic clone encoding Ara h 1. Two 100 bp oligonucleotides were synthesized and used as probes to screen a peanut genomic library constructed in a Lambda FIX II vector. After three rounds of screening, four putative positive clones were selected and their DNA digested with SacI. A unique 12-13 kb insert fragment was released, confirmed positive by Southern hybridization, subcloned into a pBluescript vector, and sequenced. Sequence analysis revealed a full-length Ara h 1 gene of 4447 bp with four exons of 721, 176, 81 and 903 bp and three introns of 71, 249 and 74 bp. The deduced amino acid encodes a protein of 626 residues that is identical to the Ara h 1 cDNA clone P41b. Several well characterized elements for promoter strength were found in the promoter region of Ara h 1 and include two TATA-boxes (TATATAAATA and TTATATATAT) at positions -89 and -348, respectively; a CAAT-box (CAAT) at position -133, a GC-box (CGGGACCGGGCCGG GCCTTCGGGCCGGGCCGGGT) at position -475, two G-boxes (TAACACGTACAC and ATGGACGTGAAA) at positions -264 and -1808, respectively; two RY elements (CATGCAC and CATGCAT) at positions -235 and -278, respectively; and other cis-element sequences. In the 3' UTR, a poly-A signal (AATAAA) was found at +2350, two additional stop codons (TAA) at +2303 and +2306, and TTTG/CTA/G motifs. Three introns and a potentially strong promoter could explain the high expression of the Ara h 1 gene. Amino acid sequence comparisons revealed high sequence similarity with other plant vicilins, member of the cupin superfamily.Entities:
Mesh:
Substances:
Year: 2003 PMID: 14597159 DOI: 10.1016/j.molimm.2003.09.002
Source DB: PubMed Journal: Mol Immunol ISSN: 0161-5890 Impact factor: 4.407