CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum.

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.