Literature DB >> 12702236

Class I integrons and SXT elements in El Tor strains isolated before and after 1992 Vibrio cholerae O139 outbreak, Calcutta, India.

S Roy Chowdhury, M Thungapathra, T Ramamurthy, G Balakrish Nair, Amit Ghosh.   

Abstract

We examined the distribution of class I integrons and SXT elements in Vibrio cholerae O1 El Tor strains, isolated in Calcutta, India, before and after the V. cholerae O139 outbreak in 1992. Class I integrons, with aadA1 gene cassette, were detected primarily in the pre-O139 strains; the SXT element was found mainly in the post-O139 strains.

Entities:  

Mesh:

Year:  2003        PMID: 12702236      PMCID: PMC2957977          DOI: 10.3201/eid0904.020317

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Since the introduction of antibiotics in the treatment of infectious diseases, antibiotic resistance has spread dramatically among microbes. The occurrence of drug-resistant strains of Vibrio cholerae is being reported with increasing frequency (). Spread of antibiotic resistance in microbes has been attributed to the mobilization of drug-resistance markers by a variety of agents (e.g., plasmids, transposons, and integrons). In V. cholerae, antibiotic-resistance determinants have traditionally been found on plasmids. Recently, in a few cases, these determinants have also been detected on integrons and a novel conjugative transposable element, SXT. Integrons are DNA elements capable of mobilizing individual gene cassettes into bacterial chromosomes by site-specific recombination. Integrons consist of a central variable region that often harbors antibiotic-resistance gene cassettes, flanked by 5´ and 3´ conserved sequences (CS) (). Integrons have been categorized into four different classes on the basis of the distinctive integrase (int) genes they carry on their 5´-CS (,). Among the different integron families, class I integrons are found to be most prevalent in drug-resistant bacteria. Class I integrons have been detected in V. cholerae O1 strains isolated in Vietnam, Thailand, and Italy (–). Their presence in V. cholerae O1 strains isolated in India, however, had not been previously reported. SXT is a transmissible genetic element that harbors resistant determinants to trimethoprim, streptomycin, sulfamethoxazole, and chloramphenicol. SXT was first discovered in V. cholerae O139 (), a new epidemic strain that emerged in the Indian subcontinent in late 1992 and displaced the V. cholerae O1 El Tor as the primary cholera-causing agent for approximately 6 months. After this period, V. cholerae O1 El Tor reemerged and became predominant (). Unlike those of the pre-O139 period, most of these poststrains were found to be resistant to trimethoprim, sulfamethoxazole, and streptomycin, and in a few cases, this resistance was found to be due to the SXT element. We describe the results of a study in which we examined, retrospectively, the presence and the relative abundance of class I integrons and SXT elements in V. cholerae El Tor O1 strains, isolated in Calcutta, before, during, and after the O139 outbreak.

The Study

A total of 58 strains of V. cholerae O1 El Tor isolated in Calcutta before (March–December 1992; group I), during (July–November 1993; group II), and after (March 1994–June 1995; group III) the V. cholerae O139 outbreak () were included in this study. These strains, belonging to ribotypes RI, RII, and RIII, were maintained in brain-heart infusion broth supplemented with 15% glycerol at –70°C and grown when needed ().

Occurrence of Class I Integrons

The 3´ conserved sequence of class I integrons is characterized by antibiotic resistance gene qacEΔ1 and the sulfonamide resistance gene sul1. To identify class I integrons, primers ATCGCAATAGTTGGCGAAGT (accession no. X15370) and GCAAGGCGGAAACCCGCGCC (accession no. X12869), specific for 3´ CS (), were amplified in this region by polymerase chain reaction as described (). A 0.8-kb product, found in 22 of the 58 isolates, was confirmed to be the 3´ CS of class I integrons by sequencing (Table). To identify the gene cassette in the class I integrons, primers previously used to amplify the region between the 5´ CS and 3´ CS () were used. All 22 strains produced a 1.0-kb amplicon, which on sequencing was found to contain the aadA1 gene that confers resistance against aminoglycosides, streptomycin, and spectinomycin (,). Nucleotide sequence of aadA1 cassette has been assigned the GenBank accession no. AY115577.
Table

Class I integron and SXT profiles of 58 Vibrio cholerae strains isolated before, during, and after the 1993, V. cholerae O139 outbreak, Calcutta

GroupStrain no.RibotypeaClass I integronSXTAntibiogramb
I
VC1
RI
+

A, N, S, Sm

VC2
RI
+

Fz, S, Sm

VC3
RII


Fz, Sm

VC5
RI
+

A, Fz, S, Sm

VC12
RI
+

N, S, Sm

VC14
RI

+
S, Sm, Tr

VC20
RI
+

N, S, Tr

VC35
RI


Fz, N

VC41
RI


A, Fz, N

VC44
RI
+

A, Fz, N, S, Sm

VC48
RI
+

A, Fz, N, S, Sm

VC54
RI
+

A, N, S, Sm

VC55
RI
+

Fz, N, S, Sm

VC59
RI
+

A, N, S, Sm

VC70
RI
+

Fz, S, Sm

VC72
RI
+

S, Sm

VC73
RI
+

S, Sm

VC80
RI
+

S, Sm

VC99
RI
+
+
A, Fz, N, S, Sm, Tr

VC100
RI
+
+
A, Fz, N, S, Sm, Tr

VC105
RI

+
S, Sm, Tr

VC106
RI
+

N, S
II
CO222
RI
+

Fz, S, Sm

CO327
RIII

+
A, N, S, Sm, Tr

CO334
RI
+
+
A, N, S, Sm, Tr

CO366
RIII

+
A, S, Sm, Tr

CO370
RIII

+
S, Sm, Tr

CO371
RI
+

S, N

CO374
RIII

+
A, N, S, Sm, Tr

CO387
RIII

+
N, S, Sm, Tr

CO394
RIII

+
A, Fz, S, Sm, Tr

CO407
RIII

+
A, Fz, N, S, Sm, Tr

CO416
RIII

+
A, N, S, Sm, Tr

CO417
RIII

+
A, N, S, Sm, Tr

CO423
RIII

+
A, N, S, Sm, Tr

CO424
RIII

+
A, Fz, N, S, Sm, Tr

CO427
RIII

+
A, Fz, N, S, Sm, Tr
III
CO458
RI
+
+
N, S, Sm, T, Tr

CO459
RIII

+
Fz, Na, N, S, Sm, Tr

CO460
RIII

+
Fz, Na, S, Sm, Tr

CO461
RI
+
+
N, S, Sm, T, Tr

CO471
RIII

+
Fz, Na, N, S, Sm, Tr

CO473
RIII

+
Fz, Na, S, Sm, Tr

CO474
RIII

+
Fz, Na, N, S, Sm, Tr

CO475
RIII

+
A, Fz, S, Sm, Tr

CO580
RIII

+
Fz, Na, N, S, Sm, Tr

CO650
RIII

+
A, Fz, N, S, Sm, Tr

CO720
RIII

+
Fz, Na, N, S, Sm, Tr

CO770
RIII

+
A, Fz, Na, S, Sm, Tr

CO810
RIII

+
Fz, Na, N, S, Sm, Tr

CO825
RIII

+
A, Fz, Na, N, S, Sm, Tr

CO835
RIII

+
Fz, Na, S, Sm, Tr

CO839
RIII

+
A, Fz, Na, N, S, Sm, Tr

CO840
RIII

+
Fz, N, S, Sm, Tr

CO860
RIII

+
A, Fz, N, S, Sm, Tr

CO910
RIII

+
Fz, N, S, Sm, Tr

CO950
RIII

+
A, Fz, N, S, Sm, Tr
CO970RIII+A, Fz, Na, N, S, Sm, Tr

aSharma et al. ()
bA, ampicillin; Cf, ciprofloxacin; Fz, furazolidone; G, gentamycin; N, neomycin; Na, nalidixic acid; S, streptomycin; Sm, sulfamethizole; T, tetracycline; Tr, trimethoprim.

aSharma et al. ()
bA, ampicillin; Cf, ciprofloxacin; Fz, furazolidone; G, gentamycin; N, neomycin; Na, nalidixic acid; S, streptomycin; Sm, sulfamethizole; T, tetracycline; Tr, trimethoprim. A total of 17 out of the 22 class I integron-bearing strains belonged to the before period. The remaining five, though isolated after June 1993, probably represented carry-over strains. These five strains belonged to the same RI ribotype as the other 16 strains from the before period (Table) and had a CTX structure identical to the other strains with RI ribotype ().

Antibiotic Resistance Profile

Resistance of V. cholerae isolates to ampicillin (10 µg), ciprofloxacin (5 µg), furazolidone (50 µg), gentamycin (10 µg), neomycin (30 µg), nalidixic acid (30 µg), streptomycin (10 µg), sulfamethizole (100 µg), tetracycline (30 µg), and trimethoprim (25 µg) were examined by using commercial discs (Hi Media, Bombay, India) as described (). An overall increase in the number of strains with resistance to a greater number of antibiotics was seen in the isolates of the post-O139 period; a fourfold increase in resistance against trimethoprim, a drug often used for the treatment of cholera in children and pregnant women, was noted. Almost all strains, from all isolation periods, were uniformly resistant to streptomycin and sulfamethizole, but none were found to be resistant to tetracycline, gentamycin, or ciprofloxacin. None of the strains examined were found to harbor any plasmid.

Presence of SXT Elements

None of the strains belonging to the ribotypes RII and RIII, which were all isolated during and after the O139 outbreak, carried the aadA1 gene cassette (coding for aminoglycoside resistance); however, they were all resistant to streptomycin. Further, all of the strains were resistant to trimethoprim. Since strains of V. cholerae, which harbor the SXT element, are resistant to streptomycin and trimethoprim (), we sought to determine if the resistance of the post-O139 strains to streptomycin and trimethoprim could be traced to an SXT element. Colony hybridization of the 58 strains with a 0.8-kb probe, specific for the SXT integrase gene (), showed that all trimethoprim-resistant strains from all isolation periods and all during and after streptomycin-resistant carried the SXT element (Table). Further, five of these strains harbored both SXT and the aadA1 gene cassette (Table). Our survey thus suggested that while the streptomycin resistance of the strains isolated before the O139 outbreak was due to the aadA1 gene cassette carried by the class I integrons, the SXT element was probably responsible for this phenotype in the post-O139 strains. All V. cholerae strains included in this study were resistant to multiple antibiotics. Since none of the strains harbored any plasmid and the resistance determinants present in the class I integrons and in the SXT element could account for only a few markers, other determinants of antibiotic resistance may exist. Dalsgaard et al. () found that the O1 strains isolated in Vietnam in 1994 and after had the ribotype identical to that found in some of the O1 strains isolated in Samutsakorn, Thailand, during and after the 1993 O139 outbreak. Both pre- and post-O139 isolates carried class I integrons with the aadA2 gene cassette. This fact led Dalsgaard et al. to conjecture that this distinct O1 strain might have been transferred between Thailand and Vietnam (). However, the possibility of its migrating from a third country could not be ruled out. The ribotype of the pre-O139, O1 Calcutta strains examined in this study was identical to that of the Samutsakorn strains (,,). However, as can be seen from the data presented here, unlike the Samutsakorn strains, these strains harbored aadA1 gene cassette.

Conclusions

We had shown previously that the post-O139, O1 strains isolated in Calcutta could have migrated to Guinea-Bissau in Africa (). Further evidence has shown that this strain, which caused an outbreak in 1994–1995, could have subsequently acquired class I integrons bearing the [ant(3”)-1a] gene cassette by a 150-kb plasmid from an unknown source (). While the class I integron with aadA1 gene cassette was widely distributed among the pre-O139 O1 strains isolated in Calcutta, it was mostly absent in the post-O139 O1 strains (Figure). This finding is in contrast to other studies involving the SXT element; 80% of all pre-O139 strains were devoid of SXT, whereas all post-O139 strains (with the exception of a few carry-over strains) had it (Figure). When the data presented in this paper are considered together with the information presented by others (,,,), it appears that both pre- and post-O139, O1 strains, isolated in Calcutta, probably could have moved to other countries and became established there.
Figure

Distribution of class I integrons and SXT elements in Vibrio cholerae El Tor strains isolated before, during, and after the O139 outbreak.

Distribution of class I integrons and SXT elements in Vibrio cholerae El Tor strains isolated before, during, and after the O139 outbreak.
  10 in total

1.  Antibiotic resistance conferred by a conjugative plasmid and a class I integron in Vibrio cholerae O1 El Tor strains isolated in Albania and Italy.

Authors:  V Falbo; A Carattoli; F Tosini; C Pezzella; A M Dionisi; I Luzzi
Journal:  Antimicrob Agents Chemother       Date:  1999-03       Impact factor: 5.191

2.  A distinctive class of integron in the Vibrio cholerae genome.

Authors:  D Mazel; B Dychinco; V A Webb; J Davies
Journal:  Science       Date:  1998-04-24       Impact factor: 47.728

3.  Molecular evidence that a distinct Vibrio cholerae O1 biotype El Tor strain in Calcutta may have spread to the African continent.

Authors:  C Sharma; A Ghosh; A Dalsgaard; A Forslund; R K Ghosh; S K Bhattacharya; G B Nair
Journal:  J Clin Microbiol       Date:  1998-03       Impact factor: 5.948

4.  Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand.

Authors:  A Dalsgaard; A Forslund; O Serichantalergs; D Sandvang
Journal:  Antimicrob Agents Chemother       Date:  2000-05       Impact factor: 5.191

5.  Site-specific integration of the conjugal Vibrio cholerae SXT element into prfC.

Authors:  B Hochhut; M K Waldor
Journal:  Mol Microbiol       Date:  1999-04       Impact factor: 3.501

Review 6.  Gene cassettes: a new class of mobile element.

Authors:  G D Recchia; R M Hall
Journal:  Microbiology       Date:  1995-12       Impact factor: 2.777

7.  Class 1 integron-borne, multiple-antibiotic resistance encoded by a 150-kilobase conjugative plasmid in epidemic vibrio cholerae O1 strains isolated in Guinea-Bissau.

Authors:  A Dalsgaard; A Forslund; A Petersen; D J Brown; F Dias; S Monteiro; K Molbak; P Aaby; A Rodrigues; A Sandström
Journal:  J Clin Microbiol       Date:  2000-10       Impact factor: 5.948

8.  Molecular characterization of Vibrio cholerae O1 biotype El Tor strains isolated between 1992 and 1995 in Calcutta, India: evidence for the emergence of a new clone of the El Tor biotype.

Authors:  C Sharma; G B Nair; A K Mukhopadhyay; S K Bhattacharya; R K Ghosh; A Ghosh
Journal:  J Infect Dis       Date:  1997-05       Impact factor: 5.226

9.  Cholera in Vietnam: changes in genotypes and emergence of class I integrons containing aminoglycoside resistance gene cassettes in vibrio cholerae O1 strains isolated from 1979 to 1996.

Authors:  A Dalsgaard; A Forslund; N V Tam; D X Vinh; P D Cam
Journal:  J Clin Microbiol       Date:  1999-03       Impact factor: 5.948

10.  Rapid spread of the new clone of Vibrio cholerae O1 biotype El Tor in cholera endemic areas in India.

Authors:  P K Bag; S Maiti; C Sharma; A Ghosh; A Basu; R Mitra; S K Bhattacharya; S Nakamura; S Yamasaki; Y Takeda; G Balakrish Nair
Journal:  Epidemiol Infect       Date:  1998-10       Impact factor: 2.451

  10 in total
  19 in total

1.  Identification of operators and promoters that control SXT conjugative transfer.

Authors:  John W Beaber; Matthew K Waldor
Journal:  J Bacteriol       Date:  2004-09       Impact factor: 3.490

2.  Phenotypic and genotypic characteristics and epidemiological significance of ctx+ strains of Vibrio cholerae isolated from seafood in Malaysia.

Authors:  Chien-Hsien Chen; Toshio Shimada; Nasreldin Elhadi; Son Radu; Mitsuaki Nishibuchi
Journal:  Appl Environ Microbiol       Date:  2004-04       Impact factor: 4.792

3.  Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp.

Authors:  Gary J Vora; Carolyn E Meador; Michele M Bird; Cheryl A Bopp; Joanne D Andreadis; David A Stenger
Journal:  Proc Natl Acad Sci U S A       Date:  2005-12-14       Impact factor: 11.205

4.  New cluster of plasmid-located class 1 integrons in Vibrio cholerae O1 and a dfrA15 cassette-containing integron in Vibrio parahaemolyticus isolated in Angola.

Authors:  Daniela Ceccarelli; Anna Maria Salvia; Joana Sami; Piero Cappuccinelli; Mauro Maria Colombo
Journal:  Antimicrob Agents Chemother       Date:  2006-07       Impact factor: 5.191

5.  Mechanism of drug resistance in clonally related clinical isolates of Vibrio fluvialis isolated in Kolkata, India.

Authors:  Vijaya Bharathi Srinivasan; Rupinder Kaur Virk; Amita Kaundal; Rupa Chakraborty; Basabjit Datta; T Ramamurthy; Asish K Mukhopadhyay; Amit Ghosh
Journal:  Antimicrob Agents Chemother       Date:  2006-07       Impact factor: 5.191

6.  Chromosomally encoded blaCMY-2 located on a novel SXT/R391-related integrating conjugative element in a Proteus mirabilis clinical isolate.

Authors:  Sohei Harada; Yoshikazu Ishii; Tomoo Saga; Kazuhiro Tateda; Keizo Yamaguchi
Journal:  Antimicrob Agents Chemother       Date:  2010-06-21       Impact factor: 5.191

7.  SXT-related integrating conjugative element in New World Vibrio cholerae.

Authors:  Vincent Burrus; Roberto Quezada-Calvillo; Joeli Marrero; Matthew K Waldor
Journal:  Appl Environ Microbiol       Date:  2006-04       Impact factor: 4.792

8.  Autonomous Replication of the Conjugative Transposon Tn916.

Authors:  Laurel D Wright; Alan D Grossman
Journal:  J Bacteriol       Date:  2016-11-18       Impact factor: 3.490

9.  Antibiotic susceptibility profiles of some Vibrio strains isolated from wastewater final effluents in a rural community of the Eastern Cape Province of South Africa.

Authors:  Anthony I Okoh; Etinosa O Igbinosa
Journal:  BMC Microbiol       Date:  2010-05-14       Impact factor: 3.605

10.  Molecular characterization of Vibrio cholerae isolates from cholera outbreaks in North India.

Authors:  Joseph J Kingston; Kuruvilla Zachariah; Urmil Tuteja; Sanjay Kumar; Harsh Vardhan Batra
Journal:  J Microbiol       Date:  2009-02-20       Impact factor: 3.422

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.