Regulatory C protein of the EcoRV modification-restriction system.

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.