The cryptic enhancer elements of the tCUP promoter.

Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter.