The Ff gene 5 single-stranded DNA-binding protein binds to the transiently folded form of an intramolecular G-quadruplex.

The Ff gene 5 protein (g5p) is classified as a single-stranded DNA-binding protein. However, we previously showed that g5p binds with high affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, that forms an intramolecular G-quadruplex [Wen, J.-D., Gray, C. W., and Gray, D. M. (2001) Biochemistry 40, 9300-9310]. In 200 mM NaCl at 37 degrees C, g5p binds to I-3 in two stages, the first stage being the formation of a discrete intermediate complex that appears to be a precursor to a saturated g5p x I-3 complex. For the present paper, CD spectroscopy and DMS methylation techniques were used to investigate the binding of g5p to the I-3 oligomer and to the truncated 26-nucleotide core of the I-3 oligomer. The core sequence, called I-3c26, was d(GGGGTCAGGCTGGGGTTGTGCAGGTC). Results were the following: (1) The g5p binds in one stage to I-3c26 in 200 mM NaCl at 37 degrees C. (2) The intermediate complex of g5p.I-3 is formed by the binding of g5p to the core sequence. (3) G-quadruplex structures are maintained in both the g5p x I-3 and g5p x I-3c26 complexes, but the bound G-quadruplex structures are altered from their respective steady-state folded forms in 200 mM NaCl. (4) CD kinetics measurements showed that the I-3c26 quadruplex folds in two stages and that a transiently folded form is apparently the same as the altered structure to which g5p binds. (5) DMS methylation protection and interference experiments identified two guanines that are differentially involved in the steady-state folded and g5p-bound G-quadruplex structures. A model for a possible I-3c26 G-quadruplex structure is described.