Literature DB >> 11912215

Quaternary structure of coronavirus spikes in complex with carcinoembryonic antigen-related cell adhesion molecule cellular receptors.

Daniel N Lewicki1, Thomas M Gallagher.   

Abstract

Oligomeric spike (S) glycoproteins extend from coronavirus membranes. These integral membrane proteins assemble within the endoplasmic reticulum of infected cells and are subsequently endoproteolyzed in the Golgi, generating noncovalently associated S1 and S2 fragments. Once on the surface of infected cells and virions, peripheral S1 fragments bind carcinoembryonic antigen-related cell adhesion molecule (CEACAM) receptors, and this triggers membrane fusion reactions mediated by integral membrane S2 fragments. We focused on the quaternary structure of S and its interaction with CEACAMs. We discovered that soluble S1 fragments were dimers and that CEACAM binding was entirely dependent on this quaternary structure. However, two differentially tagged CEACAMs could not co-precipitate with the S dimers, suggesting that binding sites were closely juxtaposed in the dimer (steric hindrance) or that a single CEACAM generated global conformational changes that precluded additional interactions (negative cooperativity). CEACAM binding did indeed alter S1 conformations, generating alternative disulfide linkages that were revealed on SDS gels. CEACAM binding also induced separation of S1 and S2. Differentially tagged S2 fragments that were free of S1 dimers were not co-precipitated, suggesting that S1 harbored the primary oligomerization determinants. We discuss the distinctions between the S.CEACAM interaction and other virus-receptor complexes involved in receptor-triggered entry.

Entities:  

Mesh:

Substances:

Year:  2002        PMID: 11912215      PMCID: PMC8060896          DOI: 10.1074/jbc.M201837200

Source DB:  PubMed          Journal:  J Biol Chem        ISSN: 0021-9258            Impact factor:   5.157


For enveloped viruses, efficient infection requires a regulated coalescence of virion and cellular membranes. Temporal and spatial regulation of this membrane fusion event must occur for viral genomes to enter into a milieu suitable for subsequent replicative processes. Protruding virion glycoproteins, each poised to induce membrane coalescence, have therefore evolved sensitivities to the environmental conditions found at entry sites. These conditions trigger coordinated and irreversible changes in virion glycoprotein conformations that can culminate in membrane fusion. Well known triggers for conformational change include cellular receptor binding (1, 2, 3, 4) and/or the low pH exposures that occur following engulfment of virus particles into endosomes (5, 6, 7). Our studies have focused on murine hepatitis coronavirus (MHV)1 as a model for understanding receptor-triggered entry processes. This virus is a well studied prototype member of the Coronaviridae, plus-strand RNA viruses that cause a wide range of diseases in humans and animals (8). Because the distinct species specificity and tissue tropism of coronavirus strains largely correlate with changes in the spike (S) protein (9, 10, 11), details about S interactions with receptors can enhance our understanding of pathogenesis. S proteins are classical type I membrane proteins, with ∼1300 residue ectodomains, 18-residue transmembrane spans, and a 38-residue cytoplasmic tail (12). Oligomerization occurs rapidly after synthesis (13) and is followed by transport through the exocytic pathway. Within the trans-Golgi network, a furin-like protease cleaves the full-length spike into two similar-sized fragments, a peripheral S1, and a membrane-anchored S2 (14, 15). S1, which associates with S2 through noncovalent interactions, is responsible for binding to cellular receptors. S2 contains the core machinery necessary for membrane fusion (16). Receptors for the MHV S proteins include numerous members of thecarcinoembryogenic antigen-relatedcell adhesion molecule (CEACAM) family, immunoglobulin-like glycoproteins that serve as entry portals for a relatively wide variety of pathogens (17, 18, 19, 20, 21). The prototype receptor for MHV, murine CEACAM isoform 1a, is a type I transmembrane glycoprotein with four Ig-like ectodomains designated as N (amino-terminal)-A1a-Ba-A2a (22). The N-domain binds to S proteins (17). After binding to a soluble N-CEACAM fragment, spikes undergo a conformational change that can, in some cases, be revealed as S1 shedding from S2 (23). This structural change may be relevant to MHV entry, as S1 separation from S2 correlates with increased membrane fusion activity (23). A conservative view is that the CEACAM binding to S releases free energy that drives the conformational changes required to promote coalescence of the virus and cell membranes. Indeed, soluble forms of CEACAM can, through binding S proteins, increase the propensity of S to fuse membranes (24). Understanding the connections between CEACAM binding and membrane fusion depends in part on a view of the actual CEACAM-binding site(s) on the S protein. Kubo et al. (25) mapped the CEACAM-binding sites to the amino-terminal 330 residues of S1, but high resolution protein structures are currently unknown. Questions also remain concerning quaternary structures, both S dimers and trimers have been proposed (13, 26). Thus, we embarked on studies assessing the oligomeric organization of S and S·CEACAM complexes. Here we report that S1, when shed from S2 or when produced independently from cDNAs, exists stably as a dimer. We discovered that S1 dimers, but not monomers, will bind to CEACAM receptors. In fact, we found that the region conferring dimerization resides at or near the CEACAM1a-binding site, an unexpected finding because oligomerization determinants in functionally analogous spike proteins of other viruses reside within the integral membrane fragments (27, 28, 29, 30, 31, 32, 33, 34, 35). Remarkably, only one CEACAM bound each S1 dimer, and we identified a novel disulfide-linked S1 conformation in S1·CEACAM complexes. Our findings refine the current understanding of CEACAM receptors as mediators of conformational change, and they form the basis for a preliminary model of receptor-triggered entry with both parallels and deviations from established paradigms for enveloped virus entry (36, 37, 38, 39, 40, 41).

Cells

HeLa-tTA and rabbit kidney clone 13 (RK13) cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (FCS). 293 EBNA cells secreting N-CEACAMFc (formerly known as sMHVR-Ig) (42) were grown in DMEM, 10% FCS containing the antibiotics G418 (100 μg/ml) and hygromycin B (200 μg/ml).

Mutagenesis of CEACAM and Spike cDNAs

We used murine CEACAM1a cDNA (22, 42) as template for PCR amplification of N-CEACAM6×His, using the primer 5′ GTCGAGTCAGTGGTGGTGGTGGTGGTGTACATGAAATCG 3′, which encodes a hexahistidine tag. We used cDNA of S (strain JHM) (43) as a template for PCR amplification of S gene and truncated S fragments. To create ST212S/Y214S/Y216S, mutagenic oligonucleotides 5′ GGTGGTTCTTTTTCTGCGTCCTATGCGGAT 3′ and its complement were used in PCRs. To generate enhanced green fluorescent protein (EGFP)-tagged spikes, we engineered pTM1-S (42) with a unique NotI restriction site using the following oligonucleotide: 5′ GGGCTCGAGTCAGCGGCCGCTCACAGGGATCCAGTGCATCCTCATGGGC 3′. EGFP DNA was PCR-amplified from pEGFP (Clontech), and 741-nucleotide Not-I/BamHI restriction fragment was cloned into the aforementioned pTM1-S(. Mutations in the CEACAM and S genes were confirmed by DNA sequencing. Restriction fragment exchanges with the vaccinia virus insertion-expression vector pTM1-S and pTM3-S1 were all performed as described previously (42). All recombinant plasmids were cloned and amplified in E. coli DH5α (for pTM1 vector) or HB101 (for pTM3 vector). Plasmids pTM1-SΔDPR2 (23) and pTM1-SEGFP were used directly, without recombination into vaccinia vectors. The SEGFP protein includes the entire SΔDPR2 followed by an eight-residue linker (ALDPPVAT) and a C-terminal 238-residue EGFP.

Generation of Recombinant Vaccinia Viruses

Plasmids were recombined into the thymidine kinase (TK) gene of vaccinia virus (strain WR) by standard methods (44), and TK-negative virus isolates were amplified in RK13 cells. TK-negative virus stocks were screened for S or CEACAM cDNA expression by co-infection with vTF7.3 (45) and immunoblot detection of the respective proteins in cell lysates, as described previously (23). We used the following vaccinia recombinants: vTM3-S1 (encodes 769-residue S1 of JHM strain); vTM3-S1330(encodes 330-residue amino-terminal S1 fragment); vTM3-S1ΔDPR1 (encodes S1 with internal deletion of residues 446–598); vTM3-S1ΔDPR2 (encodes S1 with internal deletion of residues 429–586); vTM1-SECTO(encodes 1320 residue S1/S2 lacking transmembrane span and cytoplasmic tail); vTM1-ST212S/Y214S/Y216S (encodes full-length S of JHM strain with the indicated substitutions); vTM3-CEACAMECTO (encodes N-A1-B-A2 Ig-like domains of CEACAM); vTM3-N-CEACAM6×His (encodes N-domain of CEACAM with 6 carboxyl-terminal histidines).

Preparation of Soluble CEACAM and Spike Proteins

To obtain N-CEACAMFc, 293 EBNA:N-CEACAMFc cells (42) were incubated overnight in serum-free DMEM. Culture supernatant was collected, filtered through a 0.22-μm membrane, dialyzed against PBS-P (PBS (pH 7.4) containing 0.01% protease inhibitor mixture (Sigma)), and concentrated 100-fold by ultrafiltration. In some cases, N-CEACAMFc was further purified by affinity chromatography on Sepharose-protein G (Amersham Biosciences). Supernatants typically yielded ∼2 μg of N-CEACAMFc per ml. To obtain 35S-labeled recombinant S proteins and CEACAMECTO, monolayers of HeLa-tTA cells were inoculated at 2 plaque-forming units/cell for 1 h at 37 °C with vTF7.3 and the respective recombinant vaccinia viruses. At 6 h post-infection, the medium was replaced with labeling media (DMEM, 1% dialyzed FCS lacking cysteine and methionine). After 1 h, the labeling media was replaced with serum-free labeling media supplemented with 25 μCi/ml Tran35S-label (ICN). After a 5-h incubation, the harvested media were clarified by centrifugation, dialyzed, and concentrated ∼100-fold by ultrafiltration as described above.

Immunoprecipitations

S proteins were collected from media or from cytoplasmic extracts. Extracts were obtained by lysing infected cell monolayers with PBS-P containing 0.5% Nonidet P-40, followed by removal of nuclei by centrifugation at 3000 × g for 15 min. S proteins were immunoprecipitated with N-CEACAMFc, with polyclonal anti-JHM serum (R33 serum, a gift from Dr. Stanley Perlman, University of Iowa), or with monoclonal anti-S antibody J.2.6 (J.2.6 hybridoma (46), a gift from Dr. John Fleming, University of Wisconsin, Madison) or with monoclonal anti-S antibody number 2 (a gift from Dr. Fumihiro Taguchi, National Institute of Neuroscience, Tokyo, Japan). Briefly, these Igs were bound for 4 h at 4 °C to Gamma Bind G-Sepharose beads (Amersham Biosciences). The beads were then rinsed three times with PBS-P by centrifugation and resuspension. After overnight incubation at 4 °C with media or cytoplasmic extracts, beads were rinsed by five cycles of centrifugation and resuspension with PBS-P containing 0.5% Nonidet P-40. The final bead pellets were mixed with SDS solubilizer (2% SDS, 5% β-mercaptoethanol (β-ME), 2.5% Ficoll, 0.005% bromphenol blue) for 5 min at 100 °C. Dissolved proteins were then visualized after SDS-PAGE by fluorography or immunoblotting, as described previously (23).

Velocity Gradient Ultracentrifugation

Samples containing35S-labeled S1 or S1·CEACAM complexes were overlaid onto linear 5 ml of 5–20% w/w sucrose gradients in PBS-P containing 0.01% BSA. A parallel gradient was overlaid with an extract containing the sedimentation markers horseradish peroxidase (HRPO 4 S), human immunoglobulin G1 (IgG 7 S), and E. coliβ-galactosidase (16 S). After sedimentation at 55,000 rpm at 5 °C for 5.95 h in a Beckman Spinco SW55 rotor, fractions (20 per gradient) were collected. The S proteins in gradient fractions were then immunoprecipitated and visualized by fluorography after SDS-PAGE. Sedimentation standards were identified in the fractions by enzymatic assays (HRPO by turnover of 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid substrate; IgG by immunoblotting with goat anti-human IgG:alkaline phosphatase; β-galactosidase by turnover of chlorophenol red-d-galactopyranoside substrate).

Cross-linking of Oligomeric Spikes

Dithiobis(succinimidylproprionate) (DSP) (25 mm in dimethyl sulfoxide) was added at various dilutions to35S-labeled S1 in PBS (pH 7.4). After 30 min at 22 °C, reactions were quenched with 50 mm Tris-HCl (pH 7.0). The35S-labeled S1 proteins were then immunoprecipitated with N-CEACAMFc, eluted with SDS solubilizer lacking β-ME, electrophoresed on a 4–20% polyacrylamide gradient gel under reducing and non-reducing conditions, and then visualized via fluorography.

Co-production and Immunoprecipitation of S2 and S2EGFP

vTF7.3-infected HeLa-tTA cells were lipofected with pTM1-S and with pTM1-SEFGP, alone or together, using LipofectAMINE PLUS according to manufacturer's instructions (Invitrogen). At 4 h post-lipofection, media were removed and replaced for 1 h with labeling media and then 5 h with labeling media containing 25 μCi/ml Tran35S-label. Cell monolayers were lysed with PBS-P (pH 8.5) containing 0.5% Nonidet P-40, and nuclei were pelleted by centrifugation (3000 ×g for 10 min at 4 °C). To separate 35S-labeled S1 from S2, leaving S1 associated with Sepharose beads,35S-labeled S proteins in clarified cytoplasmic extracts were captured by incubation for 4 h at 4 °C with Sepharose G:N-CEACAMFc beads, and suspensions were incubated for an additional 4 h at 37 °C before pelleting beads (3000 × g for 10 min at 4 °C). Supernatants enriched in S2 were further depleted of residual S1 by two additional cycles of incubation with fresh Sepharose G:N-CEACAMFcbeads. The final supernatants were then incubated overnight at 4 °C with Sepharose G:anti-GFP antiserum to capture S2EGFPfragments. Beads were rinsed extensively with PBS-P containing 0.5% Nonidet P-40, suspended in SDS solubilizer, and heated to 100 °C for 5 min. Dissolved proteins were visualized by immunoblot with anti-S2 mAb 10G (a gift from Drs. Stuart Siddell and Fumihiro Taguchi) (47) after SDS-PAGE. Fluorograms of immunoblots were obtained using a Molecular Dynamics Typhoon 8600 PhosphorImager.

Peripheral S1 Fragments Are Dimers

It is still unclear whether coronavirus peplomers are dimers or trimers. Vennema et al. (13) reported that MHV spikes are dimers, and Delmas and Laude (26) provided evidence for cross-linking of transmissible gastroenteritis coronavirus spikes into trimers. Noting the importance of quaternary structure in viral glycoprotein function, we decided to return to the question of S protein oligomerization in the MHV system. We initially used velocity gradient ultracentrifugation and chemical cross-linking to determine the quaternary structure of peripheral S1 fragments. We found that S1 produced independently from cDNA sedimented to an ∼9 S position on sucrose gradients (Fig. 1 A). Identical results were obtained for S1 fragments that had separated from S2 (data not shown). Formulas based on isokinetic sedimentation of globular proteins indicated that the ∼9 S material would have a molecular mass of ∼200 kDa, consistent with S1 homodimers (48). However, elongated molecules like the coronavirus spike peplomer (49) might exhibit unusual sedimentation behavior in sucrose gradients; therefore, we further addressed quaternary structure by cross-linking35S-labeled S1 with DSP, a thiol-cleavable chemical cross-linker. Cross-linked spikes were then immunoprecipitated and electrophoresed under non-reducing and reducing conditions (Fig. 1 B). S1 dimers appeared with increasing concentrations of DSP, and β-ME reduced these dimers into monomers. Extraordinarily high DSP concentrations (25 mm) did not complex35S-labeled S1 into higher order oligomers (data not shown).
Figure 1

Biochemical analysis of S1 quaternary structure.A, recombinant 35S-labeled S1 (strain JHM) was sedimented on a linear 5–20% sucrose gradient, and the 35S-labeled S1 in gradient fractions was visualized after immunoprecipitation onto Sepharose G:N-CEACAMFcbeads, SDS-PAGE, and fluorography. The positions of standards horseradish peroxidase (HRPO 4S), human IgG1 (IgG 7S), and β-galactosidase (β-Gal 16 S) are indicated above the electropherogram. B, recombinant 35S-labeled S1 was incubated at room temperature for 30 min with 0 (lane 1), 0.08 mm(lane 2), or 0.25 mm DSP (lane 3) and then immunoprecipitated onto Sepharose G:N-CEACAMFc beads and visualized via fluorography following SDS-PAGE on a 4–20% acrylamide gradient gel under non-reducing (NR) and reducing (R) conditions.

Biochemical analysis of S1 quaternary structure.A, recombinant 35S-labeled S1 (strain JHM) was sedimented on a linear 5–20% sucrose gradient, and the 35S-labeled S1 in gradient fractions was visualized after immunoprecipitation onto Sepharose G:N-CEACAMFcbeads, SDS-PAGE, and fluorography. The positions of standards horseradish peroxidase (HRPO 4S), human IgG1 (IgG 7S), and β-galactosidase (β-Gal 16 S) are indicated above the electropherogram. B, recombinant 35S-labeled S1 was incubated at room temperature for 30 min with 0 (lane 1), 0.08 mm(lane 2), or 0.25 mm DSP (lane 3) and then immunoprecipitated onto Sepharose G:N-CEACAMFc beads and visualized via fluorography following SDS-PAGE on a 4–20% acrylamide gradient gel under non-reducing (NR) and reducing (R) conditions.

CEACAM Receptor-binding Sites Are Only Present in S Oligomers

In previous experiments, we found that polyclonal anti-spike antibodies captured newly synthesized35S-labeled S proteins, whereas N-CEACAMFc, an immunoadhesion consisting of the N-domain of murine CEACAM1a linked to a carboxyl-terminal IgG1 Fc, did not. The 35S-labeled spikes bound N-CEACAMFc only after ∼30 min of maturation (23). One possible explanation for this finding was that S proteins oligomerized during the 30-min maturation process and that soluble receptors only recognized oligomers. This contention was consistent with numerous reports that glycoprotein oligomerization is required to maintain native tertiary structures (50,51). Therefore, we separated newly synthesized spikes by rate-zonal sedimentation through sucrose gradients prior to immunoprecipitation and detection on SDS-polyacrylamide gels. Polyclonal anti-spike serum captured a range of spike forms from ∼6 S to ∼14 S (Fig. 2 , 0 hour anti-S). In contrast, N-CEACAMFc specifically immunoprecipitated ∼14 S macromolecules (Fig. 2, 0 hour N-CEACAM ). When a 2-h chase period occurred prior to cell lysis and sedimentation, N-CEACAMFc and anti-S antiserum captured only the ∼14 S forms (Fig. 2, 2 hour panels). The two endoproteolytic cleavage products S1 (lower band) and S2 (upper band) indicated that most of the spikes had encountered a trans-Golgi-localized furin-like protease (14). These findings indicate that newly synthesized S proteins form CEACAM-binding sites concomitant with their oligomerization.
Figure 2

Specific capture of assembled S oligomers by N-CEACAM HeLa cells synthesizing S proteins were pulse-labeled with Tran35S-label for 30 min and either lysed immediately (0 hour) or chased for 2 h at 37 °C before lysis (2 hour). Lysates were sedimented on sucrose gradients, and S proteins in each fraction were immunoprecipitated with polyclonal antiserum (anti-S) or with N-CEACAMFc (N-CEACAM) before SDS-PAGE and visualization by fluorography. The sedimentation markers horseradish peroxidase (HRPO 4S), immunoglobulin G (IgG 7S), and β-galactosidase (B-Gal 16S) were identified in fractions from a parallel gradient by enzyme or immunodetection assays, and their positions are indicated above the electropherograms.

Specific capture of assembled S oligomers by N-CEACAM HeLa cells synthesizing S proteins were pulse-labeled with Tran35S-label for 30 min and either lysed immediately (0 hour) or chased for 2 h at 37 °C before lysis (2 hour). Lysates were sedimented on sucrose gradients, and S proteins in each fraction were immunoprecipitated with polyclonal antiserum (anti-S) or with N-CEACAMFc (N-CEACAM) before SDS-PAGE and visualization by fluorography. The sedimentation markers horseradish peroxidase (HRPO 4S), immunoglobulin G (IgG 7S), and β-galactosidase (B-Gal 16S) were identified in fractions from a parallel gradient by enzyme or immunodetection assays, and their positions are indicated above the electropherograms. We next considered whether CEACAM-binding sites disappeared when S proteins dissociated into monomers. We could address this question because our S1 preparations moderately break down when incubated for 2 h at 37 °C. On sucrose gradient sedimentation, the 37 °C-treated S1 occupied two positions, ∼9 S and ∼6 S, with ∼6 S being consistent with 110-kilodalton monomers (48) (Fig. 3 , top panel). N-CEACAMFc only precipitated the ∼9 S material (Fig. 3,bottom panel), suggesting that monomers do not contain a CEACAM-binding site. Interestingly, soluble ectodomain fragments of S2 co-sedimented with the ∼6 S S1 monomers in these gradients.
Figure 3

Influence of S1 quaternary structure on its ability to bind CEACAM. 35S-Labeled SECTOin sucrose gradient fractions was precipitated with trichloroacetic acid (top panel) or with N-CEACAMFc(bottom panel) and then detected by fluorography following SDS-PAGE. The sedimentation marker immunoglobulin G (IgG 7S) was identified in fractions from a parallel gradient by immunodetection assays, and its position is indicated above the electropherogram. The positions of S1 and S2ECTO are also indicated.

Influence of S1 quaternary structure on its ability to bind CEACAM. 35S-Labeled SECTOin sucrose gradient fractions was precipitated with trichloroacetic acid (top panel) or with N-CEACAMFc(bottom panel) and then detected by fluorography following SDS-PAGE. The sedimentation marker immunoglobulin G (IgG 7S) was identified in fractions from a parallel gradient by immunodetection assays, and its position is indicated above the electropherogram. The positions of S1 and S2ECTO are also indicated.

The Extreme Amino-terminal Portion of the Spike Participates in Oligomerization

Although many viral glycoproteins oligomerize through associations between integral membrane fragments (27, 28, 29, 30, 31, 32, 33, 34, 35), the MHV S proteins formed dimers of peripheral S1 fragments. To delineate further the sites on S1 responsible for oligomer formation, we took advantage of the discoveries of Kubo et al. (25), who determined that the amino-terminal 330 residues of S1 (S1330) can independently form a receptor-binding site. If the receptor-binding site requires oligomerization (Fig. 2, 0 hour N-CEACAM panel), then S1330might be a homodimer. If so, S1330 fragments would form hetero-oligomeric complexes with larger, complete S1 fragments (S1769) in cells concomitantly synthesizing both polypeptides. We synthesized recombinant S1769 and S1330 in HeLa cells, alone or together, using vaccinia vectors. After 2-h radiolabeling periods with Tran35S-label, we lysed the cell monolayers and immunoprecipitated the S1769 with an anti-spike mAb (J.2.6) (46). The mAb J.2.6, whose epitope we roughly mapped to residues 510–540,2 should only directly precipitate the S1769 fragment. In contrast, N-CEACAMFc would precipitate both S1769 and S1330 proteins. Indeed, N-CEACAMFc recognized and precipitated both the independently produced S1769 and S1330fragments from the media and cytoplasmic extracts (Fig. 4 ). As expected, mAb J.2.6 recognized the S1769 fragment but did not precipitate the independently produced S1330 fragment. However, mAb J.2.6 precipitated both fragments when they were co-synthesized, indicating hetero-oligomers (Fig. 4, lane 8, lower panel, arrow). Unlike the homo-oligomers, cells did not secrete S1769·S1330 hetero-oligomers (Fig. 4,lane 8, upper panel), which we interpret as a failure to adopt native glycoprotein structure in the endoplasmic reticulum (50, 52).
Figure 4

Co-immunoprecipitation of amino-terminal fragments S1 Recombinant S1 fragments of 330 or 769 residues were synthesized alone or together in HeLa cells in the presence of Tran35S-label. S fragments in the media (top panel) and cell lysates (bottom panel) were immunoprecipitated with N-CEACAMFc or with anti-spike mAb J.2.6. The J.2.6 epitope is between S1 residues 510 and 540. 35S-Labeled proteins were visualized by fluorography following SDS-PAGE.

Co-immunoprecipitation of amino-terminal fragments S1 Recombinant S1 fragments of 330 or 769 residues were synthesized alone or together in HeLa cells in the presence of Tran35S-label. S fragments in the media (top panel) and cell lysates (bottom panel) were immunoprecipitated with N-CEACAMFc or with anti-spike mAb J.2.6. The J.2.6 epitope is between S1 residues 510 and 540. 35S-Labeled proteins were visualized by fluorography following SDS-PAGE.

Each S Dimer Binds One CEACAM Molecule

Because receptors can perform an essential role in reorganizing viral spikes into structures that can mediate membrane fusion (2–4,53), we sought further details on S·CEACAM interactions. Our data indicated that relatively small S fragments bound CEACAM receptors only when combined into dimers. However, it remained uncertain whether multiple receptors could coordinately bind a single S1 dimer. We addressed this question initially by sedimenting S1·N-CEACAMFc complexes on sucrose gradients. If each S1 monomer contained a separate CEACAM-binding site, then two dimers might link to the bivalent N-CEACAMFc to form an estimated 16 S complex (48). Higher order complexes also may form at equivalent S1:N-CEACAMFcratios. However, we observed only ∼16 S complexes and no evidence of higher order aggregates (Fig. 5 ).
Figure 5

Sucrose gradient sedimentation analysis of unbound S1 and S1·N-CEACAM. A, two possibilities for the CEACAM-binding site architecture on a S1 dimer are illustrated. If only one CEACAM binds each S1 dimer, then divalent N-CEACAMFc would bind one or two S1 dimers. Alternatively, two CEACAM-binding sites could complex S1 and N-CEACAMFc into higher order oligomers. B, unbound 35S-labeled S1 and 35S-labeled S1·N-CEACAMFc complexes were sedimented on linear sucrose gradients and detected in gradient fractions after immunoprecipitation, SDS-PAGE, and fluorography. The sedimentation markers immunoglobulin G (IgG 7S) and β-galactosidase (B-gal 16S) were identified in fractions from a parallel gradient by enzyme or immunodetection assays, and their positions are indicated above the electropherograms. An ∼16 S S1·N-CEACAMFc complex was identified. There was no evidence of larger complexes in pellet fractions (not shown).

Sucrose gradient sedimentation analysis of unbound S1 and S1·N-CEACAM. A, two possibilities for the CEACAM-binding site architecture on a S1 dimer are illustrated. If only one CEACAM binds each S1 dimer, then divalent N-CEACAMFc would bind one or two S1 dimers. Alternatively, two CEACAM-binding sites could complex S1 and N-CEACAMFc into higher order oligomers. B, unbound 35S-labeled S1 and 35S-labeled S1·N-CEACAMFc complexes were sedimented on linear sucrose gradients and detected in gradient fractions after immunoprecipitation, SDS-PAGE, and fluorography. The sedimentation markers immunoglobulin G (IgG 7S) and β-galactosidase (B-gal 16S) were identified in fractions from a parallel gradient by enzyme or immunodetection assays, and their positions are indicated above the electropherograms. An ∼16 S S1·N-CEACAMFc complex was identified. There was no evidence of larger complexes in pellet fractions (not shown). We obtained additional insight into the stoichiometry of S1·N-CEACAMFc complexes by co-producing both ligands in 293 cells in the presence of Tran35S-label, ensuring that the synthesis of S1 exceeded that of N-CEACAMFc. From the radioactive media, we then precipitated 35S-labeled N-CEACAMFc in complex with 35S-labeled S1 using Sepharose-protein G beads. After electrophoretic separation of the precipitated proteins, we determined 35S-labeled S1:35S-labeled N-CEACAMFc ratios of 3.40 ± 0.05 (n = 3). Complexes in which one S1 dimer is tethered to each arm of the bivalent N-CEACAMFc (Fig. 5 A) would be expected to have an 35S-labeled S1:35S-labeled N-CEACAMFc ratio of 3.428 (42,43). We next used a series of co-immunoprecipitation tests to further address whether more than one CEACAM could simultaneously bind an S oligomer. A soluble CEACAM bound to S1 may or may not prevent the subsequent binding of another alternatively tagged (and thus distinguishable) soluble receptor. We bound recombinant S1 dimers to35S-labeled CEACAMECTO, which contains the four ectodomain fragments (N-A1-B-A2) of murine CEACAM1a (17,22). We then immunoprecipitated these complexes with N-CEACAMFc, which possesses the unique, easily captured, Fc tag. Immunoprecipitation of the 35S-labeled CEACAMECTO would indicate that both receptors bound simultaneously to S1 dimers. This receptor-binding state would be consistent with an S oligomer whose structure parallels those of influenza hemagglutinin and HIV gp120, in which each monomer (of the trimer) can bind a single cell-surface ligand (27, 54). In these assays, N-CEACAMFc did not precipitate35S-labeled CEACAMECTO fragments over a range of S1:35S-labeled CEACAM ratios (Fig. 6 , Upper, B). Anti-S1 (mAb J.2.6) precipitations showed that 35S-labeled CEACAMs indeed complexed with S1 at subsaturating levels (Fig. 6,Upper, C). We also observed diminished immunoprecipitation of S proteins by N-CEACAMFc as CEACAMECTO concentrations increased, again supporting the contention that the two different receptors could not concomitantly bind S1 dimers (Fig. 6, Upper, A).
Figure 6

Immunoprecipitation of S1· CEACAM complexes.Upper, constant amounts of recombinant S1 were incubated with increasing quantities of 35S-labeled CEACAMECTO for 12 h at 4 °C, and proteins in each aliquot were then immunoprecipitated with immobilized N-CEACAMFc (A and B) or immobilized anti-spike mAb J.2.6 (C). (Lower). Constant amounts of recombinant S1 (35S-labeled as indicated) were incubated with increasing amounts of CEACAMECTO(35S-labeled as indicated) for 12 h at 4 °C, and proteins were then affinity-purified with N-CEACAM6×His(A and B) or immunoprecipitated with mAb J.2.6 (C). The dots on the right of each panel represent the positions of the 113- and 75-kDa molecular mass markers.

Immunoprecipitation of S1· CEACAM complexes.Upper, constant amounts of recombinant S1 were incubated with increasing quantities of 35S-labeled CEACAMECTO for 12 h at 4 °C, and proteins in each aliquot were then immunoprecipitated with immobilized N-CEACAMFc (A and B) or immobilized anti-spike mAb J.2.6 (C). (Lower). Constant amounts of recombinant S1 (35S-labeled as indicated) were incubated with increasing amounts of CEACAMECTO(35S-labeled as indicated) for 12 h at 4 °C, and proteins were then affinity-purified with N-CEACAM6×His(A and B) or immunoprecipitated with mAb J.2.6 (C). The dots on the right of each panel represent the positions of the 113- and 75-kDa molecular mass markers. We considered the possibility that the large carboxyl-terminal Fc “tags” might cause an “artificial” steric hindrance in these tests. Thus, in parallel co-precipitation tests, we replaced N-CEACAMFc with N-CEACAM6×His, whose 6-residue appendage is roughly 100 times smaller than IgG Fc. N-CEACAM6×His also could not precipitate S1·35S-labeled CEACAMECTO complexes (Fig. 6, Lower, B), but it could readily bind and precipitate free S1 dimers (Fig. 6, Lower, A). Thus, for steric hindrance to account for this interference by CEACAMECTO, separate binding sites on each S1 monomer would have to be very closely juxtaposed in the dimer. We also considered the unconventional possibility that an S1 dimer contains only a single asymmetric binding site for CEACAM that is formed by different residues contributed by each S1 monomer. We synthesized S1 proteins with the changes T212S, Y214S and Y216S, which Suzuki and Taguchi (55) had shown to decrease CEACAM binding. We found that N-CEACAMFc inefficiently precipitated this mutant, but its capture increased 2-fold when hetero-oligomerized with wild-type S330 (Fig. 7 boxed bands). These results argue for a traditional view, in which each S1 monomer (in the context of a dimer) contains a complete CEACAM-binding site.
Figure 7

Increased capture of mutant S proteins with low affinity CEACAM-binding sites by heteromerization with S1 Recombinant mutant S proteins with three point mutations within the CEACAM-binding site were synthesized alone or with increasing amounts of “wild-type” S1330. S1330 synthesis was adjusted by the input multiplicity of infection (MOI) of the vTM3-S1330 vector.35S-labeled spikes were immunoprecipitated with N-CEACAMFc and visualized by fluorography following SDS-PAGE. The amount of 35S associated with the boxed bands was quantitated with a Molecular Dynamics Typhoon 8600 PhosphorImager. The left box contained 2141 cpm and the right box contained 4329 cpm.

Increased capture of mutant S proteins with low affinity CEACAM-binding sites by heteromerization with S1 Recombinant mutant S proteins with three point mutations within the CEACAM-binding site were synthesized alone or with increasing amounts of “wild-type” S1330. S1330 synthesis was adjusted by the input multiplicity of infection (MOI) of the vTM3-S1330 vector.35S-labeled spikes were immunoprecipitated with N-CEACAMFc and visualized by fluorography following SDS-PAGE. The amount of 35S associated with the boxed bands was quantitated with a Molecular Dynamics Typhoon 8600 PhosphorImager. The left box contained 2141 cpm and the right box contained 4329 cpm.

A CEACAM-induced Conformational Change of S1

Our data suggested that each monomer of the S1 dimer contained an independent CEACAM-binding site. Although sterically hindered sites might explain how only one CEACAM binds S1 oligomers, another possibility was negative cooperativity. For negative cooperativity to be a viable possibility, CEACAM would have to bind one S1 monomer (of the dimer) and induce structural rearrangements such that the adjacent monomer would have substantially reduced CEACAM affinity. Thus, we evaluated whether CEACAM binding induces structural rearrangements in S1. On considering possible assays for structural rearrangements, we noted that reduction strongly affects the electrophoretic mobility of some variant S1 fragments, ∼70 and 90 kDa before and after β-ME treatment, respectively. Thus we entertained the possibility that CEACAM binding might induce conformational changes that rearrange complex disulfide architectures, thereby creating electrophoretic mobility shifts. It is important to note that we felt any positive results might even have some biological relevance, as we had shown earlier (56) that chemicals preventing disulfide rearrangements block MHV infection by arresting S-induced membrane fusion. We exposed 35S-labeled S1 dimers to the sulfhydryl alkylating agent N-ethylmaleimide (NEM) either before or after being complexed with N-CEACAMFc at 37 °C. In parallel, a monoclonal anti-S1330 antibody (number 2) (25) was used in place of N-CEACAMFc, with the expectation that its binding would not induce conformational changes. Electropherograms of the immunoprecipitated 35S-labeled proteins revealed that a small proportion of CEACAM-bound S1 had complexed into an ∼220-kDa disulfide-linked protein (Fig. 8 A, lane 4). Thiols apparently had to be available to generate the ∼220-kDa protein, as S1 that had been pretreated with NEM bound N-CEACAMFc but did not couple into disulfide-linked oligomers (Fig. 8 A, lane 3). Formation of the ∼220-kDa protein required N-CEACAMFc, because mAb number 2 bound S1 but did not generate any electrophoretic mobility changes (Fig. 8 B, lanes 3 and 4). Collectively, these data indicate that CEACAM binding can induce structural rearrangements in the S1 dimer, revealed in this experiment by alternative disulfide linkages.
Figure 8

CEACAM-induced conformational changes in S1.35S-Labeled S1ΔDPR1 was either incubated with (+) or without (−) 10 mm NEM prior to incubation for 4 h at 4 °C and then for 1 h at 37 °C with 10 μg of N-CEACAMFc (A) or anti-S1330 mAb number 2 (B) (25). Samples not previously treated with NEM were then incubated with 10 mmNEM (+). 35S-Labeled proteins were detected by fluorography using a Molecular Dynamics Typhoon 8600 PhosphorImager following SDS-PAGE under reducing (+ B-ME) and non-reducing (− B-ME) conditions. N-CEACAMFc-induced disulfide-linked high molecular weight spikes are indicated by the *.

CEACAM-induced conformational changes in S1.35S-Labeled S1ΔDPR1 was either incubated with (+) or without (−) 10 mm NEM prior to incubation for 4 h at 4 °C and then for 1 h at 37 °C with 10 μg of N-CEACAMFc (A) or anti-S1330 mAb number 2 (B) (25). Samples not previously treated with NEM were then incubated with 10 mmNEM (+). 35S-Labeled proteins were detected by fluorography using a Molecular Dynamics Typhoon 8600 PhosphorImager following SDS-PAGE under reducing (+ B-ME) and non-reducing (− B-ME) conditions. N-CEACAMFc-induced disulfide-linked high molecular weight spikes are indicated by the *.

Quaternary Structure of S2 Fragments after Separation from S1

High resolution structural data are available for portions of many different viral spike proteins, and the images reveal strong intersubunit interactions within integral membrane (fusion-inducing) post-translational fragments (6, 30, 31, 32, 33, 34, 36, 57). Less structural data are available for the peripheral (receptor binding) fragments, but collected information often leads to models in which these peripheral subunits separate from each other during membrane fusion reactions (36,38). This “opening” of spike oligomers may expose hydrophobicity within the integral membrane fragments, a prerequisite for membrane fusion. Our discovery of stable intersubunit connections in coronavirus S1 led us to doubt whether these peripheral subunits separate during fusion, and also led us to speculate about additional oligomerization determinants in integral membrane S2 fragments. We engineered S proteins with a relatively large 238-residue EGFP appended to their cytoplasmic tails. We found that the carboxyl-terminal additions had no effect on S protein transport through the exocytic pathway, indicating that oligomerization motifs in the S ectodomains remained. Moreover, SEGFP proteins induced membrane fusion (data not shown). Therefore, these tagged S proteins allowed us to identify intersubunit associations through co-immunoprecipitation experiments. In one set of tests, we synthesized S and SEGFP, either separately or together, in the presence of Tran35S-label. We then immunoprecipitated all EGFP-tagged spikes from total cytoplasmic extracts using GFP-specific rabbit antiserum (a gift from Dr. Katherine L. Knight, Loyola University Medical Center), and we visualized S2 proteins by immunoblotting (Fig. 9 A). Uncleaved SEGFP and S2EGFP were detected (lane 2), and when co-produced with S, the untagged S2 was also detected (lane 3). This association of S2EGFP with untagged S2 was not due to a generalized aggregation of S2 chains after cell lysis, because there was no capture of S2 from mixtures of S and SEGFP lysates (lane 4). The abundance of 35S-labeled S1 in the immunoprecipitated material suggested that S1 dimers might be responsible for holding S2 and S2EGFP together (Fig. 9 B).
Figure 9

Analysis of the oligomeric organization of S2 after separation from S1.A, cDNAs encoding S or EGFP-tagged S (S) were transfected alone or together into vTF7.3-infected HeLa cells. Following metabolic labeling with Tran35S-label, cytoplasmic extracts were prepared, and EGFP-associated proteins were immunoprecipitated with polyclonal anti-GFP serum. Immunoprecipitates were then electrophoresed and immunoblotted for S2 fragments. Co indicates co-synthesis of S and SEGFP. Mix indicates that equal volumes of independently produced S and SEGFP lysates were mixed before immunoprecipitation. B, autoradiographic image of the immunoblot in A. C, cell lysates were depleted of S1 by sequential immunoprecipitations with N-CEACAMFc at pH 8.5 and 37 °C. Supernatants from the final depletions were collected, and EGFP-associated proteins were immunoprecipitated with anti-GFP serum. Immunoprecipitates were electrophoresed and immunoblotted for S2 fragments. D, autoradiographic image of the immunoblot in C. Arrows indicate the positions of uncleaved SEGFP(S), S2EGFP, untagged S2, and S1.

Analysis of the oligomeric organization of S2 after separation from S1.A, cDNAs encoding S or EGFP-tagged S (S) were transfected alone or together into vTF7.3-infected HeLa cells. Following metabolic labeling with Tran35S-label, cytoplasmic extracts were prepared, and EGFP-associated proteins were immunoprecipitated with polyclonal anti-GFP serum. Immunoprecipitates were then electrophoresed and immunoblotted for S2 fragments. Co indicates co-synthesis of S and SEGFP. Mix indicates that equal volumes of independently produced S and SEGFP lysates were mixed before immunoprecipitation. B, autoradiographic image of the immunoblot in A. C, cell lysates were depleted of S1 by sequential immunoprecipitations with N-CEACAMFc at pH 8.5 and 37 °C. Supernatants from the final depletions were collected, and EGFP-associated proteins were immunoprecipitated with anti-GFP serum. Immunoprecipitates were electrophoresed and immunoblotted for S2 fragments. D, autoradiographic image of the immunoblot in C. Arrows indicate the positions of uncleaved SEGFP(S), S2EGFP, untagged S2, and S1. We next separated S1 dimers from S2 by tethering the spikes onto Sepharose:N-CEACAMFc and then incubating at pH 8.5 and 37 °C. This condition separates S1 from S2 (58), leaving “free” S2 chains in supernatants. Sequential incubations with Sepharose:N-CEACAMFc generated S1-depleted supernatants from which anti-GFP serum immunoprecipitated free S2 chains. Here there was capture of S2EGFP (Fig. 9 C, lanes 2 and 4), but there was no evidence of co-immunoprecipitating untagged S2 (lane 3). We correlated this co-immunoprecipitation failure with the absence of S1 in the samples (Fig. 9 D). Collectively, these findings suggested that S2, when free of S1, does not exist as an oligomer.

DISCUSSION

The oligomeric spike glycoproteins of many enveloped viruses are endoproteolytically cleaved into two fragments that act in concert to mediate virion binding to receptors and subsequent uncoating through virion:cell membrane fusion. Crystal structures of the influenza hemagglutinin reveal an exterior composed of peripheral residues and their receptor-binding sites, and a core which harbors much of the integral membrane fragments, thereby sequestering the hydrophobic residues involved in membrane fusion. The dramatic conformational changes of integral membrane fragments that link opposing membranes can only be accomplished in concert with some displacement of the peripheral fragments. How this displacement process takes place remains unclear, i.e. whether the peripheral fragments symmetrically dissociate into monomers to reveal the membrane fusion apparatus, as depicted in some models (36, 38), or whether they displace asymmetrically as oligomers. We require additional insights into this process to understand the mechanisms by which antibodies neutralize virus infections and to develop chemicals that interfere with virus entry. This issue of spike protein quaternary structures both before and after fusion activation has been studied in some detail with primate lentiviruses, and some interesting findings have emerged. The peripheral (gp120) fragments that shed from spike complexes during membrane fusion can be monomers, indeed they were crystallized in this form (54), but can also exist as stable dimers (59, 60, 61) or trimers (62, 63, 64). By contrast, it is generally accepted that the integral membrane (gp41) fragments exist as trimers, at least in postfusion low energy conformations (29, 30, 32, 34, 65). Recent findings also indicate that different gp160 subunits, one with a lethal defect in receptor binding and the other unable to induce membrane fusion, can assemble together into functional heteromeric trimers (66). These findings naturally lead to the hypothesis that asymmetries can exist within gp120–41 complexes, at least in some of the conformations existent during fusion activation. Similarly, it is conceivable that asymmetries exist in murine coronavirus spikes. We found that the peripheral (S1) fragments of MHV exist as stable, homogenous dimers (Fig. 1). Although we view our data as convincing, we understand its apparent inconsistency with previous reports of trimeric associations within MHV integral membrane (S2) fragments (67). Collective findings therefore raise the possibility that asymmetric dimer-to-trimer transitions occur as part of the pathway to membrane fusion activation. In this view, closely spaced S1 fragments would dissociate as stable dimers, leaving S2 fragments to rearrange during membrane fusion into trimeric structures. Such dimer-trimer transitions are not unprecedented in virus entry, although they take place in the context of icosahedrally ordered glycoprotein lattice (68, 69). No evidence exists for ordered arrangements of spikes on the pleiomorphic coronavirus envelopes. Another interesting and potentially relevant asymmetry likely exists in S·CEACAM complexes. Only a single CEACAM binds to an S1 dimer. This was most convincingly demonstrated in our co-immunoprecipitation tests, where differentially tagged N-CEACAM fragments never captured S1·CEACAM complexes (Fig 6). Further support for a one S1 dimer:one CEACAM ratio came from our stoichiometric analyses of S1·N-CEACAMFc complexes (Fig. 5). As we consider it unlikely that only a single asymmetric binding site exists on each S1 dimer (Fig. 7), we propose two alternative possibilities. Either the two CEACAM binding sites on an S1 dimer juxtapose very closely (steric hindrance) or the binding of a single CEACAM rapidly induces global structural changes in S1 that destroy the adjacent binding site (negative cooperativity). This latter possibility has received consideration in the SIV gp140·CD4 interaction, whose stoichiometry has recently been identified as an asymmetric complex of one gp140 trimer bound to a single monomeric CD4 (63). Our data, although not yet able to distinguish between the two possibilities, nonetheless provides evidence of structural flexibility in the S proteins and thus points toward negative cooperativity as a likely scenario. We and others know that CEACAM binding induces separation of S1 from S2, a readily observed “global” conformational change (23, 58). The CEACAM-binding site is itself dependent on a more global conformation, being formed with assembly of S into oligomers (Fig. 2), and eliminated on S1 dissociation into monomers (Fig. 3). This relationship between S oligomerization and CEACAM binding may provide the structural contexts for conformational changes across S1 monomers once a CEACAM molecule binds. In support of this view, we demonstrated that N-CEACAMFc binding induced the formation of high molecular weight disulfide-linked S1 structures whose formation was blocked by pre-incubation with the sulfhydryl-alkylating agent N-ethylmaleimide (Fig. 8 A). The inability of S1330-specific mAb number 2 to induce comparable disulfide rearrangements (Fig. 8 B) further supports the contention that entry-specific conformational changes in S1 are unique to CEACAM binding. Although these findings are interesting, perhaps even suggesting a role for disulfide exchanges during coronavirus entry (56), we acknowledge that additional CEACAM-induced changes in S1 structure must be investigated to fully address how S conformations bring about virus:cell membrane fusion. We were surprised to find oligomerization control in peripheral S1 fragments, because analogous viral glycoproteins oligomerize into trimers through interactions in their integral membrane fragments. Our attempts to determine whether the S1-interacting sites represent the only oligomerization motif prompted us to construct epitope-appended S proteins, and we discovered that tags as large as the 238-residue EGFP could be added to the carboxyl (cytoplasmic) termini of S2 without interrupting oligomeric assembly, intracellular transport, and function. With these epitope-tagged S proteins, it became relatively straightforward to determine whether S2 fragments retained an oligomeric structure even after separation from S1. Thus we bound soluble CEACAMs and shifted to 37 °C, a condition known to dissociate S1 from S2 (23). We expected that this would leave free S2 chains in an oligomeric state, as primary S2 sequences predict oligomeric coiled-coils (70) similar to those found in many other viral spike proteins that carry out membrane fusion reactions (29, 30, 31, 32, 33, 34, 65). However, we did not co-immunoprecipitate S2·S2EGFPcomplexes when free of S1, suggesting S2 monomers (Fig. 9). This interesting finding raises questions about the ways that MHV S2 might fuse membranes. The generally accepted view is that the integral membrane fragments of enveloped viruses collapse into α-helical coiled-coils on bringing opposing membranes together (36, 37, 38, 39, 40, 41). It remains to be determined whether MHV S2 monomers independently adopt an anti-parallel α-helical coiled-coil arrangement that is similar to that observed for other viruses. A preliminary model of S proteins during virus entry is shown in Fig. 10 . In this figure, we depict a single CEACAM that is bound to peripheral S1 (25, 55). This bound CEACAM may preclude additional binding by steric hindrance (Fig. 10 A) or alternatively may induce conformational changes in S1 oligomers that precludes additional CEACAM binding (Fig. 10 B). Additional conformational changes are thought to occur at S1-S2 connections, resulting in the displacement of the two fragments from each other (23). These events are considered prerequisites for the insertion of a hydrophobic portion of S2 into cellular membranes (71). As little is yet known regarding the later stages of the membrane fusion process, subsequent depictions of S2 structures are not illustrated. Coronavirus S2 fragments do contain putative M-helix and C-helix regions (Fig. 10), which are predicted to form coiled-coils (70). A collapse into coiled-coil structures may bring about membrane fusion in a fashion similar to that hypothesized for the enveloped myxoviruses (39), retroviruses (29, 30, 72), and filoviruses (33, 73). We intend to use this model to generate and refine hypotheses on coronavirus entry into cells.
Figure 10

Models depicting the quaternary structure of the MHV spike and its interaction with CEACAM during virus entry. To explain a single CEACAM-binding site on S1 dimers, two models are illustrated. Model A appeals to steric hindrance, and model B suggests that a single CEACAM induces global structural rearrangements (illustrated as the change of S1 from an oval to a rectangle). These conformational changes preclude additional CEACAM binding. In both cases, CEACAM binding is hypothesized to displace S1 from S2 (23) and to permit the insertion of an internal fusion peptide (green triangle) into the target cell membrane (71).

Models depicting the quaternary structure of the MHV spike and its interaction with CEACAM during virus entry. To explain a single CEACAM-binding site on S1 dimers, two models are illustrated. Model A appeals to steric hindrance, and model B suggests that a single CEACAM induces global structural rearrangements (illustrated as the change of S1 from an oval to a rectangle). These conformational changes preclude additional CEACAM binding. In both cases, CEACAM binding is hypothesized to displace S1 from S2 (23) and to permit the insertion of an internal fusion peptide (green triangle) into the target cell membrane (71).
  41 in total

Review 1.  SARS coronavirus: a new challenge for prevention and therapy.

Authors:  Kathryn V Holmes
Journal:  J Clin Invest       Date:  2003-06       Impact factor: 14.808

2.  Conformational changes in the spike glycoprotein of murine coronavirus are induced at 37 degrees C either by soluble murine CEACAM1 receptors or by pH 8.

Authors:  Bruce D Zelus; Jeanne H Schickli; Dianna M Blau; Susan R Weiss; Kathryn V Holmes
Journal:  J Virol       Date:  2003-01       Impact factor: 5.103

3.  The coronavirus spike protein induces endoplasmic reticulum stress and upregulation of intracellular chemokine mRNA concentrations.

Authors:  Gijs A Versteeg; Paula S van de Nes; Peter J Bredenbeek; Willy J M Spaan
Journal:  J Virol       Date:  2007-08-01       Impact factor: 5.103

Review 4.  The molecular biology of coronaviruses.

Authors:  Paul S Masters
Journal:  Adv Virus Res       Date:  2006       Impact factor: 9.937

5.  Cooperative involvement of the S1 and S2 subunits of the murine coronavirus spike protein in receptor binding and extended host range.

Authors:  Cornelis A M de Haan; Eddie Te Lintelo; Zhen Li; Matthijs Raaben; Tom Wurdinger; Berend Jan Bosch; Peter J M Rottier
Journal:  J Virol       Date:  2006-09-06       Impact factor: 5.103

6.  Supramolecular architecture of severe acute respiratory syndrome coronavirus revealed by electron cryomicroscopy.

Authors:  Benjamin W Neuman; Brian D Adair; Craig Yoshioka; Joel D Quispe; Gretchen Orca; Peter Kuhn; Ronald A Milligan; Mark Yeager; Michael J Buchmeier
Journal:  J Virol       Date:  2006-08       Impact factor: 5.103

7.  Receptor-induced conformational changes of murine coronavirus spike protein.

Authors:  Shutoku Matsuyama; Fumihiro Taguchi
Journal:  J Virol       Date:  2002-12       Impact factor: 5.103

8.  Murine coronavirus with an extended host range uses heparan sulfate as an entry receptor.

Authors:  Cornelis A M de Haan; Zhen Li; Eddie te Lintelo; Berend Jan Bosch; Bert Jan Haijema; Peter J M Rottier
Journal:  J Virol       Date:  2005-11       Impact factor: 5.103

9.  The avian coronavirus infectious bronchitis virus undergoes direct low-pH-dependent fusion activation during entry into host cells.

Authors:  Victor C Chu; Lisa J McElroy; Vicky Chu; Beverley E Bauman; Gary R Whittaker
Journal:  J Virol       Date:  2006-04       Impact factor: 5.103

10.  N-terminal domain of the murine coronavirus receptor CEACAM1 is responsible for fusogenic activation and conformational changes of the spike protein.

Authors:  Hideka S Miura; Keiko Nakagaki; Fumihiro Taguchi
Journal:  J Virol       Date:  2004-01       Impact factor: 5.103

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.