Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements.

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5' GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3' end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.