Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).