Literature DB >> 11166886

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

J W Eastcott1, C J Holmberg, F E Dewhirst, T R Esch, D J Smith, M A Taubman.   

Abstract

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound to the Al(OH)3, or with Tt bound to Al(OH)3 with the addition of the CpG oligonucleotide. Antigens were administered subcutaneously in the salivary gland vicinity once, or by gastric intubation on 3 consecutive days. On day 124 all animals were given a boost with the same material by the same route. Serum IgG and saliva IgA antibody to Tt was determined by ELISA. Serum antibody levels were significantly higher in ODN+Tt treated rats than in Tt-alone rats immunized by either route after primary or booster immunizations. Thus, administration of an ODN containing unmethylated CpG motifs along with an immunogen bound to Al(OH)3 can result in enhanced specific antibody when administered by intragastric as well as subcutaneous routes.

Entities:  

Mesh:

Substances:

Year:  2001        PMID: 11166886     DOI: 10.1016/s0264-410x(00)00422-9

Source DB:  PubMed          Journal:  Vaccine        ISSN: 0264-410X            Impact factor:   3.641


  17 in total

Review 1.  Mucosal immunity: overcoming the barrier for induction of proximal responses.

Authors:  Brent S McKenzie; Jamie L Brady; Andrew M Lew
Journal:  Immunol Res       Date:  2004       Impact factor: 2.829

Review 2.  Mucosal vaccines: recent progress in understanding the natural barriers.

Authors:  Olga Borges; Filipa Lebre; Dulce Bento; Gerrit Borchard; Hans E Junginger
Journal:  Pharm Res       Date:  2009-12-01       Impact factor: 4.200

Review 3.  Novel vaccine development strategies for inducing mucosal immunity.

Authors:  Yoshiko Fujkuyama; Daisuke Tokuhara; Kosuke Kataoka; Rebekah S Gilbert; Jerry R McGhee; Yoshikazu Yuki; Hiroshi Kiyono; Kohtaro Fujihashi
Journal:  Expert Rev Vaccines       Date:  2012-03       Impact factor: 5.217

4.  DNA-based adaptive immunity protect host from infection-associated periodontal bone resorption via recognition of Porphyromonas gingivalis virulence component.

Authors:  Xiaozhe Han; Karen B LaRosa; Toshihisa Kawai; Martin A Taubman
Journal:  Vaccine       Date:  2013-09-16       Impact factor: 3.641

Review 5.  Dendritic cell-targeting DNA-based nasal adjuvants for protective mucosal immunity to Streptococcus pneumoniae.

Authors:  Kosuke Kataoka; Yoshiko Fukuyama; David E Briles; Tatsuro Miyake; Kohtaro Fujihashi
Journal:  Microbiol Immunol       Date:  2017-06       Impact factor: 1.955

Review 6.  Progress towards a needle-free hepatitis B vaccine.

Authors:  Filipa Lebre; Gerrit Borchard; Maria Conceição Pedroso de Lima; Olga Borges
Journal:  Pharm Res       Date:  2010-11-19       Impact factor: 4.200

Review 7.  CpG DNA as a vaccine adjuvant.

Authors:  Christian Bode; Gan Zhao; Folkert Steinhagen; Takeshi Kinjo; Dennis M Klinman
Journal:  Expert Rev Vaccines       Date:  2011-04       Impact factor: 5.217

8.  Periodontal bacterial DNA suppresses the immune response to mutans streptococcal glucosyltransferase.

Authors:  Martin A Taubman; Xiaozhe Han; Karen B Larosa; Sigmund S Socransky; Daniel J Smith
Journal:  Infect Immun       Date:  2007-05-21       Impact factor: 3.441

9.  Activation of Toll‐like receptor 9 inhibits lipopolysaccharide‐induced receptor activator of nuclear factor kappa‐ B ligand expression in rat B lymphocytes.

Authors:  Xiaoqian Yu; Jiang Lin; Qing Yu; Toshihisa Kawai; Martin A Taubman; Xiaozhe Han
Journal:  Microbiol Immunol       Date:  2014-01       Impact factor: 1.955

Review 10.  Dendritic cell-targeting DNA-based mucosal adjuvants for the development of mucosal vaccines.

Authors:  Kosuke Kataoka; Kohtaro Fujihashi
Journal:  Expert Rev Vaccines       Date:  2009-09       Impact factor: 5.217

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.