| Literature DB >> 10829024 |
Y Hew1, C Lau, Z Grzelczak, F W Keeley.
Abstract
Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.Entities:
Mesh:
Substances:
Year: 2000 PMID: 10829024 DOI: 10.1074/jbc.M002776200
Source DB: PubMed Journal: J Biol Chem ISSN: 0021-9258 Impact factor: 5.157