Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.