| Literature DB >> 10527846 |
T Kimura1, R Ivell, W Rust, Y Mizumoto, K Ogita, C Kusui, Y Matsumura, C Azuma, Y Murata.
Abstract
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term. Copyright 1999 Academic Press.Entities:
Mesh:
Substances:
Year: 1999 PMID: 10527846 DOI: 10.1006/bbrc.1999.1487
Source DB: PubMed Journal: Biochem Biophys Res Commun ISSN: 0006-291X Impact factor: 3.575