Literature DB >> 1052531

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

K Sugimoto, H Sugisaki, T Okamoto, M Takanami.   

Abstract

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').

Entities:  

Mesh：

Substances：

Year:  1975        PMID： 1052531      PMCID： PMC343575          DOI： 10.1093/nar/2.11.2091

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  11 in total

1.  Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter.

Authors:  D Pribnow
Journal:  Proc Natl Acad Sci U S A       Date:  1975-03       Impact factor: 11.205

2.  Studies on bacteriophage fd DNA I. A cleavage map of the fd genome.

Authors: 
Journal:  J Mol Biol       Date:  1975-06-15       Impact factor: 5.469

3.  Studies on bacteriophage fd DNA. II. Localization of RNA initiation sites on the cleavage map of the fd genome.

Authors:  T Okamoto; K Sugimoto; H Sugisaki; M Takanami
Journal:  J Mol Biol       Date:  1975-06-15       Impact factor: 5.469

4.  The nucleotide sequence of an RNA polymerase binding site on bacteriophage fd DNA.

Authors:  K Sugimoto; T Okamoto; H Sugisaki; M Takanami
Journal:  Nature       Date:  1975-02-06       Impact factor: 49.962

5.  Genetic regulation: the Lac control region.

Authors:  R C Dickson; J Abelson; W M Barnes; W S Reznikoff
Journal:  Science       Date:  1975-01-10       Impact factor: 47.728

6.  Sequence of the PR promoter of phage lambda.

Authors:  A Walz; V Pirrotta
Journal:  Nature       Date:  1975-03-13       Impact factor: 49.962

7.  5 s RNA conformation. Studies of its partial T 1 ribonuclease digestion by gel electrophoresis and two-dimensional thin-layer chromatography.

Authors:  A D Mirzabekov; B E Griffin
Journal:  J Mol Biol       Date:  1972-12-30       Impact factor: 5.469

8.  Sequence of a repressor-binding site in the DNA of bacteriophage lamda.

Authors:  T Maniatis; M Ptashne; B G Barrell; J Donelson
Journal:  Nature       Date:  1974-08-02       Impact factor: 49.962

9.  Nucleotide sequence in the promoter region of the Escherichia coli tyrosine tRNA gene.

Authors:  T Sekiya; H G Khorana
Journal:  Proc Natl Acad Sci U S A       Date:  1974-08       Impact factor: 11.205

10.  Nucleotide sequence of an RNA polymerase binding site from the DNA of bacteriophage fd.

Authors:  H Schaller; C Gray; K Herrmann
Journal:  Proc Natl Acad Sci U S A       Date:  1975-02       Impact factor: 11.205
View more
  7 in total

1.  The nucleotide sequence of a DNA fragment, 71 base pairs in length, near the origin of DNA replication of bacteriophage 0X174.

Authors:  A D Mansfeld; J M Vereijken; H S Jansz
Journal:  Nucleic Acids Res       Date:  1976-10       Impact factor: 16.971

2.  DNA regions essential for the function of a bacteriophage fd promoter.

Authors:  T Okamoto; K Sugimoto; H Sugisaki; M Takanami
Journal:  Nucleic Acids Res       Date:  1977-07       Impact factor: 16.971

3.  A computer aided oligonucleotide analysis provides a model sequence for RNA polymerase-promoter recognition in E.coli.

Authors:  G E Scherer; M D Walkinshaw; S Arnott
Journal:  Nucleic Acids Res       Date:  1978-10       Impact factor: 16.971

4.  On the mechanism of oligonucleotide-primed RNA synthesis. II. Synthesis of specific primer-initiated RNA copies suitable for DNA sequence analysis.

Authors:  C F Van Kreijl; R H Beelen; P Borst
Journal:  Nucleic Acids Res       Date:  1977-02       Impact factor: 16.971

Review 5.  Ff coliphages: structural and functional relationships.

Authors:  I Rasched; E Oberer
Journal:  Microbiol Rev       Date:  1986-12

Review 6.  Compilation and analysis of Escherichia coli promoter DNA sequences.

Authors:  D K Hawley; W R McClure
Journal:  Nucleic Acids Res       Date:  1983-04-25       Impact factor: 16.971

7.  Characterization of a R plasmid-associated, trimethoprim-resistant dihydrofolate reductase and determination of the nucleotide sequence of the reductase gene.

Authors:  J W Zolg; U J Hänggi
Journal:  Nucleic Acids Res       Date:  1981-02-11       Impact factor: 16.971
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.